Defects in the GINS complex increase the instability of repetitive sequences via a recombination-dependent mechanism

Abstract

Faithful replication and repair of DNA lesions ensure genome maintenance. During replication in eukaryotic cells, DNA is unwound by the CMG helicase complex, which is composed of three major components: the Cdc45 protein, Mcm2-7, and the GINS complex. The CMG in complex with DNA polymerase epsilon (CMG-E) participates in the establishment and progression of the replisome. Impaired functioning of the CMG-E was shown to induce genomic instability and promote the development of various diseases. Therefore, CMG-E components play important roles as caretakers of the genome. In Saccharomyces cerevisiae, the GINS complex is composed of the Psf1, Psf2, Psf3, and Sld5 essential subunits. The Psf1-1 mutant form fails to interact with Psf3, resulting in impaired replisome assembly and chromosome replication. Here, we show increased instability of repeat tracts (mononucleotide, dinucleotide, trinucleotide and longer) in yeast psf1-1 mutants. To identify the mechanisms underlying this effect, we analyzed repeated sequence instability using derivatives of psf1-1 strains lacking genes involved in translesion synthesis, recombination, or mismatch repair. Among these derivatives, deletion of RAD52, RAD51, MMS2, POL32, or PIF1 significantly decreased DNA repeat instability. These results, together with the observed increased amounts of single-stranded DNA regions and Rfa1 foci suggest that recombinational mechanisms make important contributions to repeat tract instability in psf1-1 cells. We propose that defective functioning of the CMG-E complex in psf1-1 cells impairs the progression of DNA replication what increases the contribution of repair mechanisms such as template switch and break-induced replication. These processes require sequence homology search which in case of a repeated DNA tract may result in misalignment leading to its expansion or contraction.

Recombination and Pol ζ Rescue Defective DNA Replication upon Impaired CMG Helicase—Pol ε Interaction

“…In this analysis, we used plasmids with repeat tracts as follows: (G) 18 , (GT) 25 , (AACGCAATGCG) 4 , and (CAACGCAATGCGTTGGATCT) 3 [ 107 , 108 ]. Additionally, as a control, we used a plasmid with a random nucleotide sequence inserted in frame in the URA3 gene [ 109 ]. Expansion or contraction of the repeated sequence results in out-of-frame insertion or deletion and, therefore, incorrect translation of URA3 .…”

“…Strains carrying deletions of the REV3, RAD51, RAD52, MMS2, PIF1 , or POL32 genes were constructed based on the Y1000 or Y1012 strains as previously described in [ 109 ] using the primers listed in Table S2 . Strains with the psf1-100 allele and single or double deletions were constructed by tetrad dissection from diploid strains constructed by crossing strains SC778, SC803, or Y1006 with appropriate single gene deletion MATα strains listed in Table S10 .…”

“…The ( RFA1-YFP, LEU2 ) cassette described in [ 109 ] was integrated into the RFA1 locus of the SC766 and SC778 strains. The presence of the ( RFA1-YFP, LEU2 ) allele was confirmed by PCR, using the primers RFA6231R, RFA7367F and YFP9451R ( Table S11 ).…”

“…The stability of repetitive sequences was determined, as described previously [ 109 ], with modifications. Plasmids pMD28 (18 × 1 nt), p51GT (25 × 2 nt), pMD41 (4 × 11 nt), pEAS20 (3 × 20 nt) [ 107 , 108 ] and pKK2 [ 109 ] were used for the transformation of yeast strains SC801 and SC803.…”

“…The stability of repetitive sequences was determined, as described previously [ 109 ], with modifications. Plasmids pMD28 (18 × 1 nt), p51GT (25 × 2 nt), pMD41 (4 × 11 nt), pEAS20 (3 × 20 nt) [ 107 , 108 ] and pKK2 [ 109 ] were used for the transformation of yeast strains SC801 and SC803. To determine mutation rates, 10–20 cultures of 2 independent isolates of each strain were inoculated in 2 mL of liquid SD medium, supplemented with the required amino acids and nitrogenous bases, lacking tryptophan and leucine, and grown at 30 °C.…”