Detection, isolation, and in vitro characterization of porcine parainfluenza virus type 1 isolated from respiratory diagnostic specimens in swine

First report of porcine parainfluenza virus 1 (species Porcine respirovirus 1) in Europe

“…Among the 22 herds screened, we only found a single one (4.5%) infected with the virus. Our results show a notably lower infection rate as compared to the USA where among the 842 porcine samples submitted to the Iowa State University Veterinary Diagnostic Laboratory during 2016–2017, 43.3% were positive for PPIV‐1 by qPCR; these USA results suggest that PPIV‐1 may be common in US swine, especially in animals with respiratory pathologies (Park et al., 2019). On the other hand, when lung homogenate, oral fluid or nasal swab samples of unknown infection status were tested, only 6.1% was qPCR positive for PPIV‐1 (Palinski et al., 2016).…”

“…Among the 22 herds screened, we only found a single one PPIV-1 by qPCR; these USA results suggest that PPIV-1 may be common in US swine, especially in animals with respiratory pathologies (Park et al, 2019). On the other hand, when lung homogenate, oral fluid or nasal swab samples of unknown infection status were tested, only 6.1% was qPCR positive for PPIV-1 (Palinski et al, 2016).…”

“…The L gene product used for diagnostic PCR and a partial F gene segment was sequenced, the latter using primers and conditions described in Park et al., 2019. Briefly, for the F gene an internal and an outer primer pair (F‐For: 5′‐ACTTAGGGTACAAGTTATCCAAAAAA‐3′, F‐Rev: 5′‐TCGTGCACCCTAAGTTTTCTTTA‐3′, F‐For: int 1 5′‐GAGAGAAGAGCTTAACATTACAGGC‐3′, F‐Rev: int 1 5′‐TCATAAATATCTGTYTTCCCGAGATT‐3′) was used with the One‐Step RT‐PCR Kit (Qiagen).…”

“…The reactions were performed using a One-Step RT-PCR Kit (Qiagen) in a Genesy 96T gradient PCR machine (Tianlong, China). Positive control RNA obtained from a PPIV-1 isolate was kindly provided by Phillip C. Gauger The L gene product used for diagnostic PCR and a partial F gene segment was sequenced, the latter using primers and conditions described in Park et al, 2019. Briefly, for the F gene an internal and an outer primer pair (F-For: 5′-ACTTAGGGTACAAGTTATCCAAAAAA-3′, F-Rev: 5′-TCGTGCACCCTAAGTTTTCTTTA-3′, F-For: int 1 5′-GAGAGAAGAGCTTAACATTACAGGC-3′, F-Rev: int 1 5′-TCATAAATATCTGTYTTCCCGAGATT-3′) was used with the One-…”

“…Upon full genome sequence analysis, Lau et al proposed the classification of this newly discovered virus as a novel paramyxovirus. PPIV‐1 has a negative sense, single‐stranded RNA genome approximately 15 kilobases in length consisting of six genes (3′‐N‐P‐M‐F‐HN‐L‐5′); these genes encode for major proteins: nucleocapsid, phosphoprotein, matrix, fusion, haemagglutinin–neuraminidase and large proteins, respectively (Henrickson, 2003; Lau et al., 2013; Park et al., 2017, 2019). The haemagglutinin–neuraminidase (HN) protein is responsible for the attachment of the virus to target cells via sialic acid receptors, suggesting a neuraminidase activity which is important for virus release from cells (Henrickson, 2003).…”