Development of a modified transformation platform for apomixis candidate genes research in Paspalum notatum (bahiagrass)

Mancini, Micaela; Woitovich, Nadia; Permingeat, Hugo R.; Podio, Maricel; Siena, Lorena Adelina; Ortiz, Juan Pablo Amelio; Pessino, Silvina Claudia; Felitti, Silvina Andrea

doi:10.1007/s11627-014-9596-2

Cited by 16 publications

(18 citation statements)

References 56 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…These findings suggest that PnTGS1-like may participate in the repression of AES formation in nucellar cells surrounding the legitimate germ cell lineage. To confirm our hypothesis of a pivotal role for methylation-dependent RNA processing in the emergence of asexual reproductive pathways, we are currently using a transformation platform recently established in our laboratory [ 45 ] to assess the effects of the plant specific TGS1-like protein on the reproductive development of plant model species and Paspalum notatum .…”

Section: Discussionmentioning

confidence: 99%

PnTgs1-like expression during reproductive development supports a role for RNA methyltransferases in the aposporous pathway

et al. 2014

View full text Add to dashboard Cite

BackgroundIn flowering plants, apomixis (asexual reproduction via seeds) is widely believed to result from failure of key regulators of the sexual female reproductive pathway. In the past few years, both differential display and RNA-seq comparative approaches involving reproductive organs of sexual plants and their apomictic counterparts have yielded extensive lists of candidate genes. Nevertheless, only a limited number of these genes have been functionally characterized, with few clues consequently available for understanding the molecular control of apomixis. We have previously identified several cDNA fragments with high similarity to genes involved in RNA biology and with differential amplification between sexual and apomictic Paspalum notatum plants. Here, we report the characterization of one of these candidates, namely, N69 encoding a protein of the S-adenosyl-L-methionine-dependent methyltransferases superfamily. The purpose of this work was to extend the N69 cDNA sequence and to characterize its expression at different developmental stages in both sexual and apomictic individuals.ResultsMolecular characterization of the N69 cDNA revealed homology with genes encoding proteins similar to yeast and mammalian trimethylguanosine synthase/PRIP-interacting proteins. These proteins play a dual role as ERK2-controlled transcriptional coactivators and mediators of sn(o)RNA and telomerase RNA cap trimethylation, and participate in mammals and yeast development. The N69-extended sequence was consequently renamed PnTgs1-like. Expression of PnTgs1-like during reproductive development was significantly higher in floral organs of sexual genotypes compared with apomicts. This difference was not detected in vegetative tissues. In addition, expression levels in reproductive tissues of several genotypes were negatively correlated with facultative apomixis rates. Moreover, in situ hybridization observations revealed that PnTgs1-like expression is relatively higher in ovules of sexual plants throughout development, from premeiosis to maturity. Tissues where differential expression is detected include nucellar cells, the site of aposporous initials differentiation in apomictic genotypes.ConclusionsOur results indicate that PnTgs1-like (formerly N69) encodes a trimethylguanosine synthase-like protein whose function in mammals and yeast is critical for development, including reproduction. Our findings also suggest a pivotal role for this candidate gene in nucellar cell fate, as its diminished expression is correlated with initiation of the apomictic pathway in plants.Electronic supplementary materialThe online version of this article (doi:10.1186/s12870-014-0297-0) contains supplementary material, which is available to authorized users.

show abstract

Section: Discussionmentioning

confidence: 99%

PnTgs1-like expression during reproductive development supports a role for RNA methyltransferases in the aposporous pathway

et al. 2014

View full text Add to dashboard Cite

show abstract

“…A vector containing an N46 hairpin (pBS86-N46) (Pact1D:rfa-n46-s:rga2i:rfa-n46-as:T35s/Pubi:bar:Tnos) was constructed from cloning the complete N46 fragment (451 bp) reported by Laspina et al (2008) into the selector, bar-containing plasmid pBS86 ( Thompson et al, 1987 ), which includes two insertion sites in opposite orientation (cgf-s and cgf-as). The rice act1 promoter was considered suitable, because it drives expression in male and female reproductive tissues in rice ( Zhang et al, 1991 ) and P. notatum ( Mancini et al, 2014 ). Briefly, attB1 and attB2 Gateway sequences were included in the 5′ and 3′ ends of N46-specific PCR primers (Forward primer: GGGGACAAGTTTGTACAAAAAA GCAGGCTTCCCCTCCTCCCCTGTGCCGAC; Reverse primer: GGGGAC CACTTTGTACAAGAAAGCTGGGTTAAGCCTCCCCAAACGGACCAT).…”

Section: Methodsmentioning

confidence: 99%

“…The insertion was validated by sequencing at the Plant Biotechnology Centre, Melbourne, VIC, Australia. The pBS86- N46 vector, together with the reporter plasmid pact1-gfbsd2 ( Ochiai-Fukuda et al, 2006 ) carrying the eGFP gene (encoding an enhanced green fluorescent protein) were used to co-transform P. notatum plants (Q4117 genotype) with a protocol previously developed in our laboratory ( Mancini et al, 2014 ). Transformation events were identified by PCR amplification of the transgenes from genomic DNA using the following primers: eGFPF 5′GGGGACAGCTTTCTTGTACAAAGTGGGGATGGTGAGCAAGGGCGAGGAGCT3′ ( T m : 65.4°C)/eGFPR 5′-GGGGACAACTTTGTATAAAGTTGGTTACTTGTACAGCTCGTCCATGCC-3′ ( T m : 66.1°C) (used to detect eGFP within pact1-gfbsd2) and BARXLF 5′-CCGGCGGTCTGCACCATCGT-3′ ( T m : 66°C)/BARXR 5′-ATCTCGGTGACGGGCAGGAC-3′ ( T m : 66°C) (used to detect BAR within pBS86-N46).…”

Section: Methodsmentioning

confidence: 99%

The MAP3K-Coding QUI-GON JINN (QGJ) Gene Is Essential to the Formation of Unreduced Embryo Sacs in Paspalum

et al. 2018

Self Cite

View full text Add to dashboard Cite

Apomixis is a clonal mode of reproduction via seeds, which results from the failure of meiosis and fertilization in the sexual female reproductive pathway. In previous transcriptomic surveys, we identified a mitogen-activated protein kinase kinase kinase (N46) displaying differential representation in florets of sexual and apomictic Paspalum notatum genotypes. Here, we retrieved and characterized the N46 full cDNA sequence from sexual and apomictic floral transcriptomes. Phylogenetic analyses showed that N46 was a member of the YODA family, which was re-named QUI-GON JINN (QGJ). Differential expression in florets of sexual and apomictic plants was confirmed by qPCR. In situ hybridization experiments revealed expression in the nucellus of aposporous plants’ ovules, which was absent in sexual plants. RNAi inhibition of QGJ expression in two apomictic genotypes resulted in significantly reduced rates of aposporous embryo sac formation, with respect to the level detected in wild type aposporous plants and transformation controls. The QGJ locus segregated independently of apospory. However, a probe derived from a related long non-coding RNA sequence (PN_LNC_QGJ) revealed RFLP bands cosegregating with the Paspalum apospory-controlling region (ACR). PN_LNC_QGJ is expressed in florets of apomictic plants only. Our results indicate that the activity of QGJ in the nucellus of apomictic plants is necessary to form non-reduced embryo sacs and that a long non-coding sequence with regulatory potential is similar to sequences located within the ACR.

show abstract

“…Regarding the development of protocols for modulating the expression of candidate genes in natural apomictic systems, Mancini et al [ 124 ] considered several previously developed methodologies [ 125 , 126 , 127 ] as the starting point to examine alternative explants/conditions for biolistic transformation, and designed a platform best suited to a wide range of Paspalum genotypes. Such methodology is currently being used to produce Paspalum lines with up- or downregulated expression of apomixis candidates, which are later subjected to reproductive phenotype analyses.…”

Section: Functional Analysis Of Apomixis-related Candidate Genesmentioning

confidence: 99%

How to Become an Apomixis Model: The Multifaceted Case of Paspalum

Ortiz

Pupilli

Acuña

et al. 2020

Genes

Self Cite

View full text Add to dashboard Cite

In the past decades, the grasses of the Paspalum genus have emerged as a versatile model allowing evolutionary, genetic, molecular, and developmental studies on apomixis as well as successful breeding applications. The rise of such an archetypal system progressed through integrative phases, which were essential to draw conclusions based on solid standards. Here, we review the steps adopted in Paspalum to establish the current body of knowledge on apomixis and provide model breeding programs for other agronomically important apomictic crops. In particular, we discuss the need for previous detailed cytoembryological and cytogenetic germplasm characterization; the establishment of sexual and apomictic materials of identical ploidy level; the development of segregating populations useful for inheritance analysis, positional mapping, and epigenetic control studies; the development of omics data resources; the identification of key molecular pathways via comparative gene expression studies; the accurate molecular characterization of genomic loci governing apomixis; the in-depth functional analysis of selected candidate genes in apomictic and model species; the successful building of a sexual/apomictic combined breeding scheme.

show abstract

Development of a modified transformation platform for apomixis candidate genes research in Paspalum notatum (bahiagrass)

Cited by 16 publications

References 56 publications

PnTgs1-like expression during reproductive development supports a role for RNA methyltransferases in the aposporous pathway

PnTgs1-like expression during reproductive development supports a role for RNA methyltransferases in the aposporous pathway

The MAP3K-Coding QUI-GON JINN (QGJ) Gene Is Essential to the Formation of Unreduced Embryo Sacs in Paspalum

How to Become an Apomixis Model: The Multifaceted Case of Paspalum

Contact Info

Product

Resources

About