Development of a multiplex real-time PCR assay with an internal amplification control for the detection of Campylobacter spp. and Salmonella spp. in chicken meat

Alves, Juliane; Hirooka, Elisa Yoko; Oliveira, Tereza Cristina Rocha Moreira de

doi:10.1016/j.lwt.2016.04.051

Cited by 20 publications

(12 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Multiplex real-time (mRT) PCR assay is a data analysis technique based on the real-time detection of a fluorescent signal integration in each reaction system, and this assay avoids time-consuming processes and laboratory crosscontamination (Mackay, 2004). Multiplex real-time PCR is designed using multiplex distinct dye-labeled probes, and this technique has been successfully applied to detect single or multiple foodborne pathogens simul-taneously (Wang et al, 2012;Zhang et al, 2015;Alves et al, 2016). However, general mRT-PCR assays cannot distinguish dead bacteria from viable bacteria.…”

Section: Introductionmentioning

confidence: 99%

Rapid and simultaneous quantification of viable Escherichia coli O157:H7 and Salmonella spp. in milk through multiplex real-time PCR

Zhou

Liang

Zhan

et al. 2017

Journal of Dairy Science

View full text Add to dashboard Cite

Escherichia coli O157:H7 and Salmonella spp. in milk are 2 common pathogens that cause foodborne diseases. An accurate, rapid, specific method has been developed for the simultaneous detection of viable E. coli O157:H7 and Salmonella spp. in milk. Two specific genes, namely, fliC from E. coli O157:H7 and invA from Salmonella spp., were selected to design primers and probes. A combined treatment containing sodium deoxycholate (SDO) and propidium monoazide (PMA) was applied to detect viable E. coli O157:H7 and Salmonella spp. only. Traditional culture methods and SDO-PMA-multiplex real-time (mRT) PCR assay were applied to determine the number of viable E. coli O157:H7 and Salmonella spp. in cell suspensions with different proportions of dead cells. These methods revealed consistent findings regarding the detected viable cells. The detection limit of the SDO-PMA-mRT-PCR assay reached 10 cfu/mL for Salmonella spp. and 10 cfu/mL for E. coli O157:H7 in milk. The detection limit of SDO-PMA-mRT-PCR for E. coli O157:H7 and Salmonella spp. in milk was significantly similar even in the presence of 10 cfu/mL of 2 nontarget bacteria. The proposed SDO-PMA-mRT-PCR assay is a potential approach for the accurate and sensitive detection of viable E. coli O157:H7 and Salmonella spp. in milk.

show abstract

Section: Introductionmentioning

confidence: 99%

Rapid and simultaneous quantification of viable Escherichia coli O157:H7 and Salmonella spp. in milk through multiplex real-time PCR

Zhou

Liang

Zhan

et al. 2017

Journal of Dairy Science

View full text Add to dashboard Cite

show abstract

“…of spiked chicken meat rinse without a prior enrichment step. Following 24-h enrichment, assay sensitivity was increased and detected up to 1 cfu/ml in samples contaminated with 1−10 5 cfu/ml via multiplex real-time PCR for both pathogens [59]. E .…”

Section: Discussionmentioning

confidence: 99%

A Dual Filtration-Based Multiplex PCR Method for Simultaneous Detection of Viable Escherichia coli O157:H7, Listeria monocytogenes, and Staphylococcus aureus on Fresh-Cut Cantaloupe

Feng

Jiang

et al. 2016

PLoS ONE

View full text Add to dashboard Cite

Fresh-cut cantaloupe is particularly susceptible to contamination with pathogenic bacteria, such as Escherichia coli O157:H7, Listeria monocytogenes, and Staphylococcus aureus. Therefore, development of rapid, yet accurate detection techniques is necessary to ensure food safety. In this study, a multiplex PCR system and propidium monoazide (PMA) concentration were optimized to detect all viable pathogens in a single tube. A dual filtration system utilized a filtration membrane with different pore sizes to enrich pathogens found on fresh-cut cantaloupe. The results revealed that an optimized multiplex PCR system has the ability to effectively detect three pathogens in the same tube. The viable pathogens were simultaneously detected for PMA concentrations above 10 μg/ml. The combination of a nylon membrane (15 μm) and a micro pore filtration membrane (0.22 μm) formed the dual filtration system used to enrich pathogens. The achieved sensitivity of PMA-mPCR based on this dual filtration system was 2.6 × 103 cfu/g for L. monocytogenes, 4.3 × 10 cfu/g for E. coli O157:H7, and 3.1 × 102 cfu/g for S. aureus. Fresh-cut cantaloupe was inoculated with the three target pathogens using concentrations of 103, 102, 10, and 1 cfu/g. After 6-h of enrichment culture, assay sensitivity increased to 1 cfu/g for each of these pathogens. Thus, this technique represents an efficient and rapid detection tool for implementation on fresh-cut cantaloupe.

show abstract

“…Primer yang digunakan pada penelitian ini berdasarkan literatur jurnal dengan gen target InvA yaitu InvA-F: 5' TCGTCATTCCATTACCTACC 3' dan InvA-R: 5' AAACGTTGAAAAACTGAGGA 3' yang menghasilkan panjang produk 119 bp [16]. Tahap selajutnya dilakukan karakterisasi primer untuk melihat kualitas primer dengan pengujian bioinformatika menggunakan software BLAST [12].…”

Section: Hasil Dan Diskusiunclassified

“…Konsentrasi ion Mg2+ berpengaruh besar terhadap spesifisitas dan jumlah produk (yield) PCR. Umumnya jika ion Mg2+ kurang akan menurunkan yield, sedangkan jika ion Mg2+ berlebih akan menghasilkan produk non Hasil penelitian menunjukan konsentrasi komponen PCR yang optimal ditunjukan pada Tabel 1 dengan kondisi amplifikasi berdasarkan literatur jurnal penelitian yaitu suhu denaturasi 95 oC, annealing 50 oC dan extension 72 oC dengan jumlah siklus 35 siklus [16].…”

Section: Gambar 1 Hasil Isolasi Dna Salmonella Atccunclassified

Deteksi Cepat Gen InvA pada Salmonella spp. Dengan Metode PCR

2019

View full text Add to dashboard Cite

Salmonella spp. merupakan penyebab infeksi utama pada manusia melalui rute oral dengan cara mengkontaminasi makanan dan minuman. Penyakit yang disebabkan oleh Salmonella spp. disebut salmonellosis. Salmonella spp. memiliki gen invA yang menyebabkan patogen pada manusia. Deteksi gen InvA dapat dilakukan dengan metode PCR. Tujuan penelitian ini adalah untuk pengembangan metode deteksi cepat Gen InvA pada Salmonella spp. dengan metode PCR. Tahapan metode penelitian dimulai dari kultur Salmonella ATCC, Isolasi DNA Salmonella ATCC, Analisis Kuantitatif DNA Salmonella ATCC, Desain primer spesifik untuk deteksi gen InvA, Karakterisasi primer, Optimasi komponen PCR. Hasil isolasi DNA Salmonella ATCC yang didapat dengan konsentrasi DNA sebesar 4,5 ng/ul dengan kemurnian DNA 1,66. Primer PCR yang telah didesain untuk deteksi gen InvA terdiri dari satu pasang primer, yaitu InvA-F: 5’ TCGTCATTCCATTACCTACC 3’dan InvA-R: 5’ AAACGTTGAAAAACTGAGGA 3’ yang menghasilkan produk PCR gen InvA sepanjang 119 bp. Gen InvA dapat dideteksi dengan cepat menggunakan metode PCR yang telah dioptimasi komponen PCR.

show abstract

Development of a multiplex real-time PCR assay with an internal amplification control for the detection of Campylobacter spp. and Salmonella spp. in chicken meat

Cited by 20 publications

References 21 publications

Rapid and simultaneous quantification of viable Escherichia coli O157:H7 and Salmonella spp. in milk through multiplex real-time PCR

Rapid and simultaneous quantification of viable Escherichia coli O157:H7 and Salmonella spp. in milk through multiplex real-time PCR

A Dual Filtration-Based Multiplex PCR Method for Simultaneous Detection of Viable Escherichia coli O157:H7, Listeria monocytogenes, and Staphylococcus aureus on Fresh-Cut Cantaloupe

Deteksi Cepat Gen InvA pada Salmonella spp. Dengan Metode PCR

Contact Info

Product

Resources

About