Development of Real-Time PCR Primer and Probe Sets for Detecting Degenerated and Non-degenerated Forms of the Butanol-Producing Bacterium Clostridium acetobutylicum ATCC 824

Lee, Sun Mi; Cho, Min Ok; Um, Youngsoon; Sang, Byoung In

doi:10.1007/s12010-009-8788-4

Cited by 8 publications

(5 citation statements)

References 13 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Species abundance was measured by quantitative PCR using primers for C. acetobutylicum [22] and W. succinogenes (forward primer (5’→3’): CCACACGACACTACCCTCAC and reverse primer (5’→3’): CGGTGCTTACGATTCCCAGT) on a 7300 Real Time PCR System (AB Applied Biosystems, CA, USA). Both primer sets are selective for the target species and the quantification of genes is corrected with the number of genes on the genome.…”

Section: Methodsmentioning

confidence: 99%

Model-based quantification of metabolic interactions from dynamic microbial-community data

et al. 2017

View full text Add to dashboard Cite

An important challenge in microbial ecology is to infer metabolic-exchange fluxes between growing microbial species from community-level data, concerning species abundances and metabolite concentrations. Here we apply a model-based approach to integrate such experimental data and thereby infer metabolic-exchange fluxes. We designed a synthetic anaerobic co-culture of Clostridium acetobutylicum and Wolinella succinogenes that interact via interspecies hydrogen transfer and applied different environmental conditions for which we expected the metabolic-exchange rates to change. We used stoichiometric models of the metabolism of the two microorganisms that represents our current physiological understanding and found that this understanding - the model - is sufficient to infer the identity and magnitude of the metabolic-exchange fluxes and it suggested unexpected interactions. Where the model could not fit all experimental data, it indicates specific requirement for further physiological studies. We show that the nitrogen source influences the rate of interspecies hydrogen transfer in the co-culture. Additionally, the model can predict the intracellular fluxes and optimal metabolic exchange rates, which can point to engineering strategies. This study therefore offers a realistic illustration of the strengths and weaknesses of model-based integration of heterogenous data that makes inference of metabolic-exchange fluxes possible from community-level experimental data.

show abstract

Section: Methodsmentioning

confidence: 99%

Model-based quantification of metabolic interactions from dynamic microbial-community data

et al. 2017

View full text Add to dashboard Cite

show abstract

“…Com as flutuações dos preços do petróleo e crescimento das preocupações ambientais, a bioenergia vem atraindo os olhares de vários pesquisadores, por se mostrar uma solução promissora ao efeito estufa e as crises energéticas (LEE et al, 2010;KANNO et al, 2013).…”

Section: Perspectivas Sobre O Meio Ambiente Produção E Uso Do Biobutanolunclassified

Atividade Bioquímica De Bactérias Produtoras De Biobutanol

Costa¹,

Santos²,

Amaral³

2022

ENCIBIO

View full text Add to dashboard Cite

RESUMOA substituição dos combustíveis fósseis pelos biocombustíveis é de grande importância econômica, uma vez que há um constante aumento de preço do petróleo em decorrência da diminuição de suas reservas, ou mesmo por questões ambientais, que incentivam a procura por combustíveis provenientes de fontes renováveis e que proporcionem menor emissão de gases indutores do efeito estufa. Várias espécies de Clostridium são capazes de produzir o solvente acetona, butanol e etanol (ABE) pela fermentação de variados substratos. Nesse cenário, o butanol tem se tornado um interessante substituto para o etanol em aplicação como aditivos de combustíveis, devido às suas propriedades físico-químicas. Foi provado que é possível utilizar o butanol diretamente em motores à gasolina, sem necessidade de modificação. No entanto, há uma dificuldade na produção de ABE por esses microrganismos, devido ao fato de o produto fermentado ser tóxico a eles, quando em altas concentrações, evidenciando a necessidade de métodos que os tornem mais resistentes a esta toxicidade, ou que não haja contato do produto com o microrganismo. Outro gargalo corresponde ao fato de a rota bioquímica de produção de butanol ainda apresentar custo elevado, quando comparada com a rota petroquímica, especialmente devido ao alto custo dos componentes do meio de cultivo. Visando tornar a produção biotecnológica do butanol mais competitiva, esforços vêm sendo feitos para minimizar o custo desse processo. O objetivo deste trabalho foi reunir os principais aspectos envolvidos para a produção de biobutanol, através de informações atualizadas sobre tecnologias e processos de produção no setor industrial.

show abstract

“…In Clostridium acetobutylicum ATCC 824, the most well-known butanol-producing microorganism, degeneration is caused by the loss of the pSOL1 plasmid contained in solventogenic genes [94]. In Clostridium acetobutylicum ATCC 824, the most well-known butanol-producing microorganism, degeneration is caused by the loss of the pSOL1 plasmid contained in solventogenic genes [94].…”

Section: Continuous Fermentationmentioning

confidence: 99%

“…Degeneration of the strain responsible for ABE fermentation is one of the frequently reported problems for the longterm continuous process. In Clostridium acetobutylicum ATCC 824, the most well-known butanol-producing microorganism, degeneration is caused by the loss of the pSOL1 plasmid contained in solventogenic genes [94]. In the case of butanol-hyper producing Clostridium saccharoperbutylacetonicum N1-4, its degeneration mechanism is related to a malfunction of the regulator for the sol operon or the upward regulatory protein [95].…”

Section: Continuous Fermentationmentioning

confidence: 99%

Quest for sustainable bio-production and recovery of butanol as a promising solution to fossil fuel

Maiti

Gallastegui

Brar

et al. 2015

Int. J. Energy Res.

View full text Add to dashboard Cite

Summary Biobutanol has conventionally been generated by fermentation of carbohydrates derived from biomass (starch or sugar‐based feedstock, such as corn) using Clostridia strains (mainly C. beijerinckii and C. acetobutylicum) under anaerobic conditions in batch mode. Under these premises, it has been tough for the acetone–butanol–ethanol fermentation to compete with petro‐butanol production from an energy efficiency and material consumption standpoint. Challenges for butanol production from biomass comprised high cost of feedstock, scarcity of hyper‐butanol producing bacteria and low butanol yield, volumetric productivity and titre, leading to high water usage and separation‐purification costs. This article is an up‐to‐date review on several under explored sections, such as optimization of fermenter feed, microbial culture responsible for solvent production (co‐culture techniques and electro‐biochemical process), latest recovery techniques and the studies integrating in situ continuous fermentation processes. Biobutanol refinery way forward should build upon the use of low‐cost lignocellulosic matter and zero cost organic wastes and by‐products from food, agriculture, forestry, fermentation and paper industries as feedstock; optimized fermentation of such diversified feed with appropriate hyper‐butanol producing strains in biofilm reactors and integration of fermentation step with hybrid high butanol‐selective recovery techniques. Copyright © 2015 John Wiley & Sons, Ltd.

show abstract

Development of Real-Time PCR Primer and Probe Sets for Detecting Degenerated and Non-degenerated Forms of the Butanol-Producing Bacterium Clostridium acetobutylicum ATCC 824

Cited by 8 publications

References 13 publications

Model-based quantification of metabolic interactions from dynamic microbial-community data

Model-based quantification of metabolic interactions from dynamic microbial-community data

Atividade Bioquímica De Bactérias Produtoras De Biobutanol

Quest for sustainable bio-production and recovery of butanol as a promising solution to fossil fuel

Contact Info

Product

Resources

About