Differential expression of ATP-binding cassette and/or major facilitator superfamily class efflux pumps contributes to voriconazole resistance in Aspergillus flavus

Natesan, Suganthini Krishnan; Lamichchane, A.K.; Swaminathan, Subramanian; Wu, Wenjuan

doi:10.1016/j.diagmicrobio.2013.04.022

Cited by 32 publications

(32 citation statements)

References 66 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…17 However, it is worth noting that the so-called strains resort to other resistance mechanisms, the most notable of which is multidrug resistance efflux pumps (MDR-EPs). 7 The primary role of efflux proteins entails freeing the cells from amassed drug through energy consumption and consequently, preventing the concentration of drug from exceeding beyond the optimum level of growth inhibition.…”

Section: Introductionmentioning

confidence: 99%

“…7 The primary role of efflux proteins entails freeing the cells from amassed drug through energy consumption and consequently, preventing the concentration of drug from exceeding beyond the optimum level of growth inhibition. 17 MDR-EPs is reckoned as one of the mechanisms that determines drug resistance in yeasts either by mutation or overexpression, two of the sub-categories of which are ATP-binding cassette (ABC) and major facilitator superfamily (MFS) which can have determining roles in fungal drug resistance. On the basis of recent studies, voriconazole-resistant A.flavus demonstrates a wide range of MDR1, 2, 4overexpression as compared with the wild-type strain.…”

Section: Introductionmentioning

confidence: 99%

“…On the basis of recent studies, voriconazole-resistant A.flavus demonstrates a wide range of MDR1, 2, 4overexpression as compared with the wild-type strain. 17 …”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

The Utilization of RNA Silencing Technology to Mitigate the Voriconazole Resistance of Aspergillus Flavus; Lipofectamine-Based Delivery

Nami¹,

Baradaran²,

Mansoori³

et al. 2017

Adv Pharm Bull

View full text Add to dashboard Cite

Purpose: Introducing the effect of RNAi in fungi to downregulate essential genes has made it a powerful tool to investigate gene function, with potential strategies for novel disease treatments. Thus, this study is an endeavor to delve into the silencing potentials of siRNA on cyp51A and MDR1 in voriconazole-resistant Aspergillus flavus as the target genes. Methods: In this study, we designed three cyp51A-specific siRNAs and three MDR1-specific siRNAs and after the co-transfection of siRNA into Aspergillus flavus, using lipofectamine, we investigated the effect of different siRNA concentrations (5, 15, 25, 50nM) on cyp51A and MDR1 expressions by qRT-PCR. Finally, the Minimum Inhibitory Concentrations (MICs) of voriconazole for isolates were determined by broth dilution method. Results: Cyp51A siRNA induced 9, 22, 33, 40-fold reductions in cyp51A mRNA expression in a voriconazole-resistant strain following the treatment of the cells with concentrations of 5, 15, 25, 50nM siRNA, respectively. Identically, the same procedure was applied to MDR1, even though it induced 2, 3, 4, 10-fold reductions. The results demonstrated a MIC for voriconazole in the untreated group (4µg per ml), when compared to the group treated with cyp51A-specific siRNA and MDR1-specific siRNA, both at concentrations of 25 and 50nM, yielding 2µg per ml and 1µg per ml when 25 nM was applied and 2µg per ml and 0.5µg per ml when the concentration doubled to 50 nM. Conclusion: In this study, we suggested that siRNA-mediated specific inhibition of cyp51A and MDR1 genes play roles in voriconazole-resistant A.flavus strain and these could be apt target genes for inactivation. The current study promises a bright prospect for the treatment of invasive aspergillosis through the effective deployment of RNAi and gene therapy.

show abstract

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

The Utilization of RNA Silencing Technology to Mitigate the Voriconazole Resistance of Aspergillus Flavus; Lipofectamine-Based Delivery

Nami¹,

Baradaran²,

Mansoori³

et al. 2017

Adv Pharm Bull

View full text Add to dashboard Cite

show abstract

“…The mechanism of azole resistance in Aspergillus fumigatus is well studied. Missense mutations and alteration of cis regulatory regions in the LDM coding gene CYP51A have been found to be the dominant mechanisms of azole resistance in A. fumigatus (9)(10)(11)(12), whereas studies to evaluate the mechanism of azole resistance in A. flavus are sparse (13)(14)(15). The present study is an attempt to understand the mechanism of azole resistance in A. flavus.…”

mentioning

confidence: 99%

A Novel Y319H Substitution in CYP51C Associated with Azole Resistance in Aspergillus flavus

Paul

Rudramurthy

Meis

et al. 2015

Antimicrob Agents Chemother

View full text Add to dashboard Cite

cThis study aimed to explore any mutation in the CYP51 gene conferring azole resistance in Aspergillus flavus. Two voriconazoleresistant and 45 voriconazole-susceptible isolates were included in the study. Sequence analysis demonstrated a T1025C nucleotide change in CYP51C, resulting in the Y319H amino acid substitution in one resistant isolate. However, the earlier described T788G mutation in CYP51C conferring voriconazole resistance in A. flavus isolates was present in all isolates, irrespective of their susceptibility status. Aspergillus flavus is the second leading cause of invasive aspergillosis in immunocompromised patients and the predominant causative agent of fungal rhinosinusitis and fungal eye infections (endophthalmitis and keratitis) in tropical countries, like India, Sudan, Kuwait,. Voriconazole is used primarily to treat infections caused by A. flavus. Long-term azole therapy may predispose A. flavus to acquire resistance to azoles, including voriconazole Lanosterol 14 ␣-demethylase (LDM), which catalyzes the ratelimiting step in the ergosterol biosynthetic pathway, serves as the primary target for azole antifungal drugs. The mechanism of azole resistance in Aspergillus fumigatus is well studied. Missense mutations and alteration of cis regulatory regions in the LDM coding gene CYP51A have been found to be the dominant mechanisms of azole resistance in A. fumigatus (9-12), whereas studies to evaluate the mechanism of azole resistance in A. flavus are sparse (13-15). The present study is an attempt to understand the mechanism of azole resistance in A. flavus.Two non-wild-type (non-WT) clinical isolates of A. flavus, NCPPF 761157 and NCCPF 760815, with higher MIC values for voriconazole than for the respective wild-type (WT) cutoff value, and 4 WT isolates were initially used ( Table 1). The wild type and non-wild type were defined on the basis of epidemiological cutoff values (ECV), with the non-WT having a voriconazole MIC of Ͼ1 g/ml and WT with a voriconazole MIC of Յ1 g/ml (16). The non-WT strain, NCCPF 761157, was isolated from a sputum sample from a patient with chronic obstructive pulmonary disease, and NCCPF 760815 was isolated from a nasal tissue sample from a patient from India having granulomatous fungal rhinosinusitis. Forty-five additional WT A. flavus clinical isolates were included to screen and validate the mutations (single-nucleotide polymorphisms [SNPs] and indels). Identification of the isolates was done by sequencing partial ␤-tubulin and calmodulin genes using primers bt2a (GGTAACCAAATCGGTGCTGCTTTC) and bt2b (ACCCTCAGTGTAGTGACCCTTGGC), and cmdA7 (GCCAAA ATCT TCATCCGTAG) and cmdA8 (ATTTCGTTCAGAATGCC AGG) (17, 18). Antifungal susceptibility testing was done as per CLSI and EUCAST guidelines (19)(20)(21)(22). Coding sequences of the close homologues of CYP51A of A. fumigatus in A. flavus, namely CYP51A (GenBank accession no. XM_002375082.1), CYP51B (GenBank accession no. XM_002379089.1), and CYP51C (GenBank accession no. XM_002383890.1), were downloaded from GenBank (http://www.nc...

show abstract

“…Efflux of rhodamine 6G (R6G). The efflux of R6G was determined using previously published protocols (Brun et al, 2004;Natesan et al, 2013;Shukla et al, 2003). Briefly, approximately 1|10 8 conidia ml 21 of the azole-sensitive strain AF17 and azole-resistant strain AF23 were incubated in YPD medium at 37 uC for 8 h (early exponential growth phase).…”

mentioning

confidence: 99%

An in vitro and in vivo study on the synergistic effect and mechanism of itraconazole or voriconazole alone and in combination with tetrandrine against Aspergillus fumigatus

Song

Zhang

et al. 2015

Journal of Medical Microbiology

View full text Add to dashboard Cite

Differential expression of ATP-binding cassette and/or major facilitator superfamily class efflux pumps contributes to voriconazole resistance in Aspergillus flavus

Cited by 32 publications

References 66 publications

The Utilization of RNA Silencing Technology to Mitigate the Voriconazole Resistance of Aspergillus Flavus; Lipofectamine-Based Delivery

The Utilization of RNA Silencing Technology to Mitigate the Voriconazole Resistance of Aspergillus Flavus; Lipofectamine-Based Delivery

A Novel Y319H Substitution in CYP51C Associated with Azole Resistance in Aspergillus flavus

An in vitro and in vivo study on the synergistic effect and mechanism of itraconazole or voriconazole alone and in combination with tetrandrine against Aspergillus fumigatus

Contact Info

Product

Resources

About