Drosophila and Vertebrate Casein Kinase Iδ Exhibits Evolutionary Conservation of Circadian Function

Fan, Jin-Yuan; Preuss, Fabian; Muskus, Michael J.; Bjes, Edward S.; Price, Jeffrey L.

doi:10.1534/genetics.108.094805

Cited by 31 publications

(49 citation statements)

References 54 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The relative lack of effect of CK1ε disruption on circadian period suggests that the primary molecular target of these inhibitors within the circadian system is CK1␦. Recent studies in flies suggest that vertebrate CK1␦ is better able to interact with fly clock proteins than is vertebrate CK1ε and that CK1␦ interacts with these fly components in a manner more functionally equivalent to Drosophila DOUBLETIME (13,28). Thus, CK1␦ may possess more conserved function within the circadian clockwork than CK1ε (13).…”

Section: Discussionmentioning

confidence: 99%

Casein Kinase 1 Delta Regulates the Pace of the Mammalian Circadian Clock

Etchegaray

Machida

Noton

et al. 2009

Molecular and Cellular Biology

205

192

View full text Add to dashboard Cite

Both casein kinase 1 delta (CK1␦) and epsilon (CK1) phosphorylate core clock proteins of the mammalian circadian oscillator. To assess the roles of CK1␦ and CK1 in the circadian clock mechanism, we generated mice in which the genes encoding these proteins (Csnk1d and Csnk1e, respectively) could be disrupted using the Cre-loxP system. Cre-mediated excision of the floxed exon 2 from Csnk1d led to in-frame splicing and production of a deletion mutant protein (CK1␦ ⌬2 ). This product is nonfunctional. Mice homozygous for the allele lacking exon 2 die in the perinatal period, so we generated mice with liver-specific disruption of CK1␦. In livers from these mice, daytime levels of nuclear PER proteins, and PER-CRY-CLOCK complexes were elevated. In vitro, the half-life of PER2 was increased by ϳ20%, and the period of PER2::luciferase bioluminescence rhythms was 2 h longer than in controls. Fibroblast cultures from CK1␦-deficient embryos also had long-period rhythms. In contrast, disruption of the gene encoding CK1 did not alter these circadian endpoints. These results reveal important functional differences between CK1␦ and CK1: CK1␦ plays an unexpectedly important role in maintaining the 24-h circadian cycle length.Circadian rhythms are rhythms in gene expression, metabolism, physiology, and behavior that persist in constant environmental conditions with a cycle length near 24 h. In mammals, the circadian timing system is hierarchical. The primary pacemaker regulating circadian behavioral rhythms is located in the suprachiasmatic nuclei (SCN) of the hypothalamus. Most cell types express circadian clock genes and will express rhythmicity in vitro. In vivo, the SCN entrains peripheral oscillators through a complex set of physiological and hormonal rhythms (31,32,36).At the molecular level, circadian oscillations are governed by a cell-autonomous negative-feedback loop in which transcription factors drive the expression of their own negative regulators, leading to oscillation between periods of transcriptional activation and repression (reviewed in references 32 and 36). The bHLH-PAS containing transcription factors CLOCK or NPAS2 form heterodimers with BMAL1. These heterodimers binds to E-box elements within regulatory regions of Period (Per1, Per2, and Per3) and Cryptochrome (Cry1 and Cry2) genes to stimulate their transcription. Approximately 12 h after transcriptional activation, PER and CRY proteins reach concentrations sufficient to form repressor complexes that inhibit the activity of the CLOCK/NPAS2:BMAL1 heterodimer, reducing the transcription of Per and Cry genes and subsequently relieving PER/CRY-mediated negative feedback. E-box-mediated expression of other transcription factors, including members of the DBP/HLF/TEF and nuclear orphan receptor families (e.g., Rev-Erb␣ and ROR-A), provides a mechanism for clock control of genes with diverse promoters and with gene expression peaks occurring at a variety of phases.Posttranslational modifications of circadian clock proteins play a well-established role in the re...

show abstract

Section: Discussionmentioning

confidence: 99%

Casein Kinase 1 Delta Regulates the Pace of the Mammalian Circadian Clock

Etchegaray

Machida

Noton

et al. 2009

Molecular and Cellular Biology

205

192

View full text Add to dashboard Cite

show abstract

“…While full-length wild-type DBT-MYC (DBT WT ) (440 amino acids) exhibited robust mobility shifts in the presence of okadaic acid, none of the mutant proteins truncated within the nonconserved C-terminal domain at the indicated amino acids exhibited robust mobility shifts (Fig. 1C), demonstrating that the sites leading to mobility shifts are likely to be in the C-terminal domain (note that we have previously shown that these truncated forms are active kinases, so the lack of mobility shift does not arise from lack of kinase activity [21]). In addition, assessment of cells treated with both okadaic acid and the proteasome inhibitor MG132 did not produce extensive mobility shifts for the mutant DBTs (Fig.…”

Section: Wild-type Dbt Autophosphorylates Its C-terminal Domainmentioning

confidence: 77%

“…WT -MYC-HIS, -DBT K/R-MYC-HIS, and -CKI-V5 and pMT expressing various DBTs with deletions of the DBT C terminus (296, 332, and 387 amino acids remaining) have been described previously (5,21). Mutations of 6 serines/threonines in the DBT C terminus to alanine were generated by two successive site-directed mutageneses using a QuikChange kit (Stratagene, CA), with the following primers for rounds I and II: DBTC/alaIF, CAACATGGACGACGCGATGGCGGCCGCCAACGCGGCGAGACCG CCGTAC; DBTC/alaIR:, GTACGGCGGTCTCGCCGCGTTGGCGGCC GCCATCGCGTCGTCCATGTTG; DBTC/alaIIF, CCGCCGTACGACGC GCCGGAGCGTCGGCCTGCGATACGGATGCGG; and DBTC/alaIIR, CC GCATCCGTATCGCAGGCCGACGCTCCGGCGCGTCGTACGGCGG.…”

Section: S2 Cell Transfection and Expression Analysis Pmt-dbtmentioning

confidence: 99%

“…The constructs were cotransfected with a puromycin resistance plasmid into Drosophila S2 cells and stable transformants selected in the presence of puromycin as described by the supplier (Invitrogen, CA). Expression of DBT with CuSO 4 induction and okadaic acid treatment with or without MG132 (50 M) were performed as previously described (5,21). Cells were either lysed directly in SDS buffer for SDS-PAGE analysis or processed for immunoprecipitation as described below.…”

Section: S2 Cell Transfection and Expression Analysis Pmt-dbtmentioning

confidence: 99%

“…They are over 86% identical in amino acid sequence in their N-terminal domains (7,19,20). While the noncatalytic C-terminal regions show no sequence homology, we have recently shown that the C-terminal domain inhibits DBT kinase activity and that DBT is autophosphorylated (21), suggesting that the C-terminal domain of DBT may regulate DBT in the same manner that vertebrate CKI␦/ε are regulated.…”

mentioning

confidence: 95%

See 2 more Smart Citations

Drosophila DBT Autophosphorylation of Its C-Terminal Domain Antagonized by SPAG and Involved in UV-Induced Apoptosis

Fan

Means

Bjes

et al. 2015

Molecular and Cellular Biology

Self Cite

View full text Add to dashboard Cite

Drosophila DBT and vertebrate CKI/␦ phosphorylate the period protein (PER) to produce circadian rhythms. While the C termini of these orthologs are not conserved in amino acid sequence, they inhibit activity and become autophosphorylated in the fly and vertebrate kinases. Here, sites of C-terminal autophosphorylation were identified by mass spectrometry and analysis of DBT truncations. Mutation of 6 serines and threonines in the C terminus (DBT C/ala ) prevented autophosphorylation-dependent DBT turnover and electrophoretic mobility shifts in S2 cells. Unlike the effect of autophosphorylation on CKI␦, DBT autophosphorylation in S2 cells did not reduce its in vitro activity. Moreover, overexpression of DBT C/ala did not affect circadian behavior differently from wild-type DBT (DBT WT ), and neither exhibited daily electrophoretic mobility shifts, suggesting that DBT autophosphorylation is not required for clock function. While DBT WT protected S2 cells and larvae from UV-induced apoptosis and was phosphorylated and degraded by the proteasome, DBT C/ala did not protect and was not degraded. Finally, we show that the HSP-90 cochaperone spaghetti protein (SPAG) antagonizes DBT autophosphorylation in S2 cells. These results suggest that DBT autophosphorylation regulates cell death and suggest a potential mechanism by which the circadian clock might affect apoptosis.T he circadian clock produces daily changes in a wide range of physiological activities, as exemplified by the sleep-wake cycle, and is also essential for seasonal changes in response to changing photoperiods. It is found in single-cell organisms such as cyanobacteria as well as multicellular organisms such as humans (1). The disruption of the clock can cause many health problems, including metabolic disease, sleep disorders, or even cancers in humans (2), so it is important to understand its mechanism from both basic and clinical perspectives.Circadian clocks are the result of oscillations of several circadian clock proteins, including those of the period protein (PER) (3). In flies and humans, the casein kinase I ortholog (called the doubletime or dbt protein in flies) is essential for the oscillations of PER because it phosphorylates PER during the day and early evening to cause PER degradation (4-8). During the late night, DBT phosphorylation of PER is reduced, and PER accumulates in the nucleus as a consequence of its interaction with the timeless protein (TIM), which antagonizes phosphorylation of PER by DBT to confer rhythmic regulation of the per and tim genes (9, 10). Hence, the rhythmic phosphorylation of PER by of DBT is essential for the rhythmic accumulation of PER protein and transcriptional feedback that underlie the circadian clock (4-7).In such a mechanism, anything that confers temporal regulation to DBT activity would contribute to the oscillations. Clearly, one such regulator is the timeless protein (TIM), which is degraded in response to light (11-13) but whose accumulation at night leads to a PER/TIM heterodimer in which DBT activity ...

show abstract

Animal clocks: a multitude of molecular mechanisms for circadian timekeeping

Pegoraro

Tauber

2011

WIREs RNA

View full text Add to dashboard Cite

Studies in various model organisms reveal that the expression level of a substantial part of the transcriptome and the proteome exhibits regular daily oscillations. These oscillations are translated to physiological and behavioral rhythms allowing organisms to efficiently anticipate and respond to the daily and seasonally changing environment (e.g., temperature and light). A rather small subset of evolutionary conserved genes drives these oscillations and constitutes the core molecular circadian clock. Here, we review the multiple mechanisms that coexist at various molecular and cellular levels and are involved in the metazoan circadian clock, including transcription/translation negative feedback loops, post-transcriptional and post-translational modifications, intracellular translocation, and intercellular signaling.

show abstract

Drosophila and Vertebrate Casein Kinase Iδ Exhibits Evolutionary Conservation of Circadian Function

Cited by 31 publications

References 54 publications

Casein Kinase 1 Delta Regulates the Pace of the Mammalian Circadian Clock

Casein Kinase 1 Delta Regulates the Pace of the Mammalian Circadian Clock

Drosophila DBT Autophosphorylation of Its C-Terminal Domain Antagonized by SPAG and Involved in UV-Induced Apoptosis

Animal clocks: a multitude of molecular mechanisms for circadian timekeeping

Contact Info

Product

Resources

About