Employing the one-cell C. elegans embryo to study cell division processes

Abstract

The one-cell Caenorhabditis elegans embryo offers many advantages for mechanistic analysis of cell division processes. Conservation of key genes and pathways involved in cell division makes findings in C. elegans broadly relevant. A key technical advantage of this system is the ability to penetrantly deplete essential gene products by RNA interference (RNAi) and replace them with wild-type or mutant versions expressed at endogenous levels from single copy RNAi-resistant transgene insertions. This ability to precisely perturb essential genes is complemented by the inherently highly reproducible nature of the zygotic division that facilitates development of quantitative imaging assays. Here, we detail approaches to generate targeted single copy transgene insertions that are RNAi-resistant, to engineer variants of individual genes employing transgene insertions as well as at the endogenous locus, and to in situ tag genes with fluorophores/purification tags. We also describe imaging assays and common image analysis tools employed to quantitatively monitor phenotypic effects of specific perturbations on meiotic and mitotic chromosome segregation, centrosome assembly/function, and cortical dynamics/cytokinesis.

Polo-like kinase 1 independently controls microtubule-nucleating capacity and size of the centrosome

“…To generate the strains expressing transgenic GFP::SPD-5 with the individual S170A, T178A, and T198A mutations (used in Fig. 3, E and J ), CRISPR was used as previously described ( Hattersley et al, 2018 ) to directly introduce the mutations into the reencoded region of the WT spd-5 transgene. Worms from the strain OD2435 were injected with purified Cas9 mixed with crRNA and trans-activating crispr RNA (tracrRNA; Integrated DNA Technologies) and an appropriate repair template (S170A mutation: crRNA 5′-GGA​GTT​AGA​ACT​CTC​AGC​TA-3′, repair template 5′-TCA​AAT​GAA​GGA​GTT​CGA​AGC​TCA​GAA​GCA​CGC​TAT​GGA​AGA​GCG​CAT​TAA​GGA​GTT​AGA​GCT​CGC​TGC​TAC​TGA​CGC​TAA​TAA​TAC​GAC​CGT​TGG​ATC​ATT​TCG​AGG​AAC​ACT​CGA​TGA​TAT​CCT​CAA​GAA​G-3′; T178A mutation: crRNA 5′-GAC​GCT​AAT​AAT​ACG​ACC​GT-3′, repair template 5′-GAA​GCA​CGC​TAT​GGA​AGA​GCG​CAT​TAA​GGA​GTT​AGA​ACT​CTC​AGC​TAC​GGA​CGC​TAA​TAA​CAC​TGC​AGT​TGG​ATC​ATT​TCG​AGG​AAC​ACT​CGA​TGA​TAT​CCT​CAA​GAA​GAA​TGA​CCC​AGA​CTT​TAC​T-3′; and T198A mutation: crRNA 5′-CTG​AAG​TAA​GAG​TAA​AGT​CT-3′, repair template 5′-CGG​AAC​TCG​AAG​ACC​ACA​TCC​AAC​AGC​TTA​GAC​AGG​AGC​TCG​ACG​ACC​AAG​CAG​CAC​GAC​TTG​CAG​ATT​CTG​AAA​ACG​TTA​GAG​CAC​AGC​TGG​AAG​CTG​CTA​CTG​GGC​AGG​GTA​TTC​TGG​GA-3′).…”

A Non-canonical BRCT-Phosphopeptide Recognition Mechanism Underlies RhoA Activation in Cytokinesis

“…To generate the plk-1 analog sensitive allele (C52V, L115G [42];), CRISPR-Cas9 was used as previously described [43]. The C52V mutation was introduced at the endogenous plk-1 locus by injecting adult worms with a mixture containing 27 mM of ribonucleoprotein particle (RNP) containing a crRNA targeting plk-1 (GGACGATTTTTGGGCAAGGG), and an oligonucleotide to repair the cut and generate the C52V mutation (CCACTTTTCCAGCGACAACCTCGCGTGTTGCTCGATTCGTAAGCTCATAAACGTGAGCGAATCCTC CTTTGCCCAAAAATCGTCCTTTCTCATAATAGGTCCCACGATCCTTGTCGGC).…”

The G2-to-M Transition Is Ensured by a Dual Mechanism that Protects Cyclin B from Degradation by Cdc20-Activated APC/C

“…For the generation of a cyb-3 null allele, we used a co-CRISPR strategy in which dpy-10 was co-edited together with the cyb-3 locus (Arribere et al, 2014;Kim et al, 2014;Hattersley et al, 2018). N2 wild-type worms were injected with a mixture containing purified Cas9, tracrRNA, two crRNAs flanking the cyb-3 coding sequence and a crRNA targeting dpy-10.…”