Endophytic bacteria from Piper tuberculatum Jacq.: isolation, molecular characterization, and in vitro screening for the control of Fusarium solani f. sp piperis, the causal agent of root rot disease in black pepper (Piper nigrum L.)

Research Article Detection of sequences related to biosynthesis of antifungal metabolites and identification of a <em>PhzF</em>-like gene in a <em>Pseudomonas rhizobacterium</em> of <em>Piper tuberculatum</em>

“…Bacterial cells of P. putida Pt12 isolate obtained by Nascimento et al (2015) were cultured in tryptone soybean medium (Himedia, India) and used for isolation of genomic DNA according to methodology described by the same authors. Genomic DNA samples were quantified using a Qubit fluorometer (Invitrogen, USA) and evaluated by electrophoresis in agarose gel stained with ethidium bromide.…”

“…For Phenazine PhzF, PHEPUT-F1 (5'GCAGCGCATCGCCGAAGAGAACA3') and PHEPUT-R1 (5'GTAACGGCGATGCCGCGCACAT3') primers based on Accession JX843728.1 from GenBank were designed using the Vector NTI Advance version 11.1 (Invitrogen, USA). Primers for the 16S rDNA gene, used as a positive control, were the same used by Nascimento et al (2015). For PhzF and 16S rDNA primers, we used 55 o C for annealing temperature with the same PCR conditions reported by Nascimento et al (2015).…”

“…Among PGPR, Pseudomonas bacteria have been useful for the control of plant diseases caused by many pathogens, including fungi, such as Macrophomina phaseolina (Vanitha and Ramjegathesh, 2014), Fusarium spp. (Sarhan and Shehata, 2014;Nascimento et al, 2015), and Glomerella tucumensis (Hassan et al, 2011).…”

“…Among Pseudomonas spp. with potential to control phytopathogens, Nascimento et al (2015) reported a Pseudomonas putida (Pt12 isolate) associated with roots of Piper tuberculatum Jacq., a Piperaceae occurring in the Amazon region with known resistance to infection by Fusarium solani f. sp. piperis (Albuquerque et al, 2001).…”

“…The Pt12 isolate showed potential to control root rot disease of black pepper, since it was able to inhibit the in vitro growth of F. solani f. sp. piperis 39% (Nascimento et al, 2015). However, the inhibition mechanisms are still unknown.…”