Enzymatic synthesis of glycosylated puerarin using maltogenic amylase fromBacillus stearothermophilusexpressed inBacillus subtilis

Abstract

The crude BSMA produced from a host generally recognized as safe (B. subtilis) can be used to transglycosylate various functional compounds. The expression system developed in this study will be helpful for the production of other food-grade enzymes by B. subtilis.

Enzymatic Synthesis of Puerarin Glucosides Using Leuconostoc Dextransucrase

“…Consequently, the purification yield of P-Gs was approximately 39% of the initially supplied P. In this study, two P-Gs were synthesized with a high yield of 53% by using LLDexT. This yield is similar to that in the production of transfer products by Bacillus subtilis maltogenic amylase [4] and the yield was high relative to its concentration of 2.3 mg/g in kudzu root [15]. The position of the C-glucopyranoside group in the parent isoflavone was determined by heteronuclear multiplebound correlation (HMBC) between the anomeric proton G-1 (δ H 4.80) and C-7 (δ C 163.0) and between C-8 (δ C 112.7) and C-8a (δ C 156.8) ( Fig.…”

Overproduction of a thermostable 4‐α‐glucanotransferase by codon optimization at N‐terminus region

“…The shuttle vector, pUBRT29, used in this study was derived from pUB110 . Generally, pUB110‐derived plasmids frequently exhibit segregational instability .…”

“…In order to express the genes for TTαGT and its codon‐optimized variants in B. subtilis , an E. coli–B. subtilis shuttle vector, pUBRT29, was used . The amyR2 promoter derived from B. subtilis NA64 was amplified by PCR using pR2CGTI‐5 as the template with two synthetic primers (F‐XbaI, 5′‐ CTCTCTAGACCCATTCTTCTTTTTATCG‐3′ and R‐NdeI, 5′‐AATCTTCATATGGTATACCTCCTCATCGTA‐3′) and digested with XbaI and NdeI, followed by digestion with XbaI and NdeI and ligation with pUBRT29 to yield the pUBRTA vector.…”

Over‐expression, secretion, biochemical characterisation, and structure analysis of Bacillus subtilis aminopeptidase

“…Compared with E. coli , Bacillus subtilis is ‘generally regarded as safe’ and is attractive due to its short fermentation period, easy handling and efficient secretion of enzymes. It has been widely used in the food industry for the production of secretory proteins and traditional fermented foods . Nevertheless, the expression of AP in the B. subtilis expression system has not been reported.…”