Erk5 in Bone Marrow Mesenchymal Stem Cells Regulates Bone Homeostasis by Preventing Osteogenesis in Adulthood

Abstract

Extracellular signal-regulated kinase 5 (Erk5) belongs to the mitogen-activated protein kinase (MAPK) family. Previously, we demonstrated that Erk5 directly phosphorylates Smad specific E3 ubiquitin protein ligase 2 (Smurf2) at Thr 249 (Smurf2 Thr249) to activate its E3 ubiquitin ligase activity. Although we have clarified the importance of Erk5 in embryonic mesenchymal stem cells (MSCs) on skeletogenesis, its role in adult bone marrow (BM)-MSCs on bone homeostasis remains unknown. Leptin receptor-positive (LepR +) BM-MSCs represent a major source of bone in adult bone marrow and are critical regulators of postnatal bone homeostasis. Here, we identified Erk5 in BM-MSCs as an important regulator of bone homeostasis in adulthood. Bone marrow tissue was progressively osteosclerotic in mice lacking Erk5 in LepR + BM-MSCs with age, accompanied by increased bone formation and normal bone resorption in vivo. Erk5 deficiency increased the osteogenic differentiation of BM-MSCs along with a higher expression of Runx2 and Osterix, essential transcription factors for osteogenic differentiation, without affecting their stemness in vitro. Erk5 deficiency decreased Smurf2 Thr249 phosphorylation and subsequently increased Smad1/5/8-dependent signaling in BM-MSCs. The genetic introduction of the Smurf2 T249E mutant (a phosphomimetic mutant) suppressed the osteosclerotic phenotype in Erk5-deficient mice. These findings suggest that the Erk5–Smurf2 Thr249 axis in BM-MSCs plays a critical role in the maintenance of proper bone homeostasis by preventing excessive osteogenesis in adult bone marrow.

Effect of Osteoblast‐Specific Deletion of the Proton Receptor OGR1

“…( 27 ) The Col1a‐Cre allele was identified by PCR using the following primers: forward 5′‐cctggaaaatgcttctgtccgtttgcc‐3′, and reverse primer 5′‐gagttgatagctggctggtggcagatg‐3′. In this system, the Cre gene is under the control of the 2.3‐kb proximal fragment of the alpha1(I)‐collagen promoter, which is expressed at very high levels in mature osteoblasts, ( 27 , 28 , 29 ) and we estimate about 70% Cre efficiency in recombination, based on immunofluorescent staining of cultured osteoblasts for the presence of OGR1. Multiple slides were analyzed for the absence or presence of OGR1; negative staining indicated successful recombination.…”

Amelioration of Osteoarthritis Development by Daily Oral Supplementation of Royal Jelly

“…To determine cell viability, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2Htetrazolium bromide (MTT) assay was performed, as previously described. 20) For RNA analyses, reverse transcription-quantitative PCR was performed with specific primers for each gene, 21) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the reference gene.…”

The role of CDK8 in mesenchymal stem cells in controlling osteoclastogenesis and bone homeostasis

“…Cells were transfected with gamma-activated sequence (GAS) reporter vector using the lipofection method, as previously described ( Horie et al., 2022 ), followed by the preparation of cell lysates and subsequent determination of luciferase activity using specific substrates in a GloMax-Multi Detection System (Promega).…”