Essential Role of Cyclization Sequences in Flavivirus RNA Replication

Abstract

A possible role in RNA replication for interactions between conserved complementary (cyclization) sequences in the 5-and 3-terminal regions of Flavivirus RNA was previously suggested but never tested in vivo. Using the M-fold program for RNA secondary-structure predictions, we examined for the first time the base-pairing interactions between the covalently linked 5 genomic region (first ϳ160 nucleotides) and the 3 untranslated region (last ϳ115 nucleotides) for a range of mosquito-borne Flavivirus species. Base-pairing occurred as predicted for the previously proposed conserved cyclization sequences. In order to obtain experimental evidence of the predicted interactions, the putative cyclization sequences (5 or 3) in the replicon RNA of the mosquito-borne Kunjin virus were mutated either separately, to destroy base-pairing, or simultaneously, to restore the complementarity. None of the RNAs with separate mutations in only the 5 or only the 3 cyclization sequences was able to replicate after transfection into BHK cells, while replicon RNA with simultaneous compensatory mutations in both cyclization sequences was replication competent. This was detected by immunofluorescence for expression of the major nonstructural protein NS3 and by Northern blot analysis for amplification and accumulation of replicon RNA. We then used the M-fold program to analyze RNA secondary structure of the covalently linked 5-and 3-terminal regions of three tick-borne virus species and identified a previously undescribed additional pair of conserved complementary sequences in locations similar to those of the mosquito-borne species. They base-paired with ⌬G values of approximately ؊20 kcal, equivalent or greater in stability than those calculated for the originally proposed cyclization sequences. The results show that the base-pairing between 5 and 3 complementary sequences, rather than the nucleotide sequence per se, is essential for the replication of mosquito-borne Kunjin virus RNA and that more than one pair of cyclization sequences might be involved in the replication of the tick-borne Flavivirus species.Despite its essential role in the virus replication cycle as a template for the synthesis of minus-strand RNA, the conformation of the genomic RNA of Flavivirus species has not been defined. Particularly important is the mode of its presentation to the RNA-dependent RNA polymerase NS5, and possibly other components of the replicase complex (RC) (28, 51), in order for copying to commence correctly from the 3Ј end. The size of the Flavivirus genome is about 11 kb, and the complete nucleotide sequence is available for a range of species, (7, 12, 14-16, 18, 25, 27, 29, 33, 40, 45, 54). All sequences share a common gene order (5Ј-C prM E NS1 NS2A NS2B NS4A NS4B NS5-3Ј), i.e., structural (C, prM, and E) followed by nonstructural (NS) genes, and are flanked by 5Ј and 3Ј untranslated regions (UTR) of about 100 and 600 nucleotides, respectively (39). Conserved complementary cyclization sequences (CS) of 8 nucleotides in the 5Ј region of the c...

Complete genome characterization of Rocio virus (Flavivirus: Flaviviridae), a Brazilian flavivirus isolated from a fatal case of encephalitis during an epidemic in São Paulo state

“…The CS1 (GCATATTGACACCTGGGAAAGAC) and CS2 (GGACTAGAGGTTAGAGGAGACCC) of ROCV are nearly identical to the corresponding conserved sequences among YFV, DENV and JEV (Chambers et al, 1990;Hahn et al, 1987;Khromykh et al, 2001). On the other hand, the 39-terminal sequence of the CS3 of ROCV (CCCCAGGA-GGACTGGGTTTTCAAAGC) is slightly degenerate or different.…”

“…Moreover, the putative changes in the highly conserved regions related to important biological functions of the flaviviruses (survival and/or pathogenicity) were recognized (Bryant et al, 2005;Khromykh et al, 2001). Khromykh et al (2001) demonstrated that at least one base-pairing between the 59-39 termini, rather than the nucleotide sequences per se, is essential for the replication of viral RNA of the mosquito-borne Kunjin virus, a member of the JEV group, and that more than one pair of cyclization sequences might be involved in the replication of the tick-borne flaviviruses.In terms of CS organization in the 39-NCR, our results revealed a CS3-CS2-RCS2-CS1 pattern for ROCV. This CS organization for ROCV is very similar to but distinct from that of the JEV group viruses (RCS3-CS3-RCS2-CS2-CS1).…”

“…The secondary structures in the 39-NCR and cyclization between the 39-and 59-terminal regions were analysed with the mfold program (Zuker et al, 1999). The first 200 nt of the genome representing the entire 59-NCR followed by a part of the C gene and the entire 39-NCR were used for the analysis, as these two terminal regions of flaviviruses contain the domains for genome cyclization between them as well as highly conserved sequences in the 39-NCR (Khromykh et al, 2001). …”

A stable full-length yellow fever virus cDNA clone and the role of conserved RNA elements in flavivirus replication

“…This 59-CS is actually part of the flavivirus coding sequence. It has been suggested that the flavivirus 59-CS sequence base pairs with CS1 via a longrange RNA interaction (Hahn et al, 1987;Khromykh et al, 2001). This interaction is predicted to result in a 'panhandle'-like structure that is hypothesized to be required for virus replication by modulating virus translation .…”

Diverse roles and interactions of RNA structures during the replication of positive-stranded RNA viruses of humans and animals

“…2(c) (Gebhard et al, 2011;Villordo & Gamarnik, 2009). In DENV, cyclization is essential for negative-strand synthesis (Alvarez et al, 2005a;Khromykh et al, 2001;Lo et al, 2003), and a balance between both conformations is critical for virus replication (Villordo et al, 2010). DENV genome replication is dependent on activation of viral RdRp via binding 59NCR stem loop SLA and genome cyclization to reposition the activated replication complex at the 39NCR transcription initiation site (Filomatori et al, 2011;Filomatori et al, 2006).…”