Evidence of functional Cd94 polymorphism in a free-living house mouse population

Knutsen, Linn Emilie; Dissen, Erik; Saether, Per C.; Bjørnsen, Elisabeth Gyllensten; Piálek, Jaroslav; Storset, Anne K.; Boysen, Preben

doi:10.1007/s00251-018-01100-x

Cited by 2 publications

(2 citation statements)

References 55 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…musculus, with a minor contribution of ssp. domesticus as reported previously (Knutsen et al, 2019). The ages of feral mice could not be determined, but only visibly adult individuals were included.…”

Section: Animals and Experimental Designmentioning

confidence: 99%

A Model System for Feralizing Laboratory Mice in Large Farmyard-Like Pens

et al. 2021

Self Cite

View full text Add to dashboard Cite

Laboratory mice are typically housed under extremely clean laboratory conditions, far removed from the natural lifestyle of a free-living mouse. There is a risk that this isolation from real-life conditions may lead to poor translatability and misinterpretation of results. We and others have shown that feral mice as well as laboratory mice exposed to naturalistic environments harbor a more diverse gut microbiota and display an activated immunological phenotype compared to hygienic laboratory mice. We here describe a naturalistic indoors housing system for mice, representing a farmyard-type habitat typical for house mice. Large open pens were installed with soil and domestic animal feces, creating a highly diverse microbial environment and providing space and complexity allowing for natural behavior. Laboratory C57BL/6 mice were co-housed in this system together with wild-caught feral mice, included as a source of murine microbionts. We found that mice feralized in this manner displayed a gut microbiota structure similar to their feral cohabitants, such as higher relative content of Firmicutes and enrichment of Proteobacteria. Furthermore, the immunophenotype of feralized mice approached that of feral mice, with elevated levels of memory T-cells and late-stage NK cells compared to laboratory-housed control mice, indicating antigenic experience and immune training. The dietary elements presented in the mouse pens could only moderately explain changes in microbial colonization, and none of the immunological changes. In conclusion, this system enables various types of studies using genetically controlled mice on the background of adaptation to a high diversity microbial environment and a lifestyle natural for the species.

show abstract

Section: Animals and Experimental Designmentioning

confidence: 99%

A Model System for Feralizing Laboratory Mice in Large Farmyard-Like Pens

et al. 2021

Self Cite

View full text Add to dashboard Cite

show abstract

“…Furthermore, wild-caught and control laboratory mice from Norway were obtained from a previously reported material ( 6 , 21 ). The Mus musculus identity of the wild mice were confirmed as previously described ( 22 ) or by PCR genotyping based on the Mus musculus -specific GAPDH gene sequences using two sets of primers (forward 5’-TGGCCGGATACCTAGTTCCA-3’; reverse 5’-AGGTGAATCAGGGAAGCAGC-3’, and forward 5’- AACAACTGGCTTTCCACCCA -3’; reverse 5’-ACTGCCTGGTAAAGGTCACG-3’). The specific pathogen-free (SPF) C57BL/6 and BALB/c laboratory mouse controls were obtained from Charles River/Scanbur, Norway, Huafukang Bioscience, Beijing, or bred in-house at the Centralized Animal Facilities at the Hong Kong Polytechnic University.…”

Section: Methodsmentioning

confidence: 99%

Mast Cells Are Identified in the Lung Parenchyma of Wild Mice, Which Can Be Recapitulated in Naturalized Laboratory Mice

et al. 2021

Self Cite

View full text Add to dashboard Cite

BackgroundIt is well documented that laboratory mice bred and maintained in ultra-hygienic specific pathogen-free (SPF) barriers display reduced richness and complexity of microbiota compared with wild mice. The laboratory mice profoundly lack lung parenchymal mast cells. Hence, we aimed to investigate the lung distribution of mast cells in free-living wild mice.MethodsWild house mice were trapped in South-Eastern Norway and Hemtabad, West Bengal, India. C57BL/6 laboratory mice were bred in a purposefully built, closed environment with bedding material obtained from the natural environment in order to normalize the gut microbiota of these laboratory mice to that of the wild mice, and the offspring were collected for study at eight weeks of age.ResultsMast cells were easily identified at a substantial density in the lung parenchymal tissues of wild mice from both Norway and India, which stands in clear contrast to the rare distribution of lung parenchymal mast cells in the conventional laboratory SPF mice. Consistently, wild mice also expressed higher pulmonary levels of stem cell factor, a critical growth factor for mast cell survival. Higher levels of histamine were recorded in the lung tissues of the wild mice. Interestingly, “naturalized” C57BL/6 laboratory mice which spent their entire life in a semi-natural environment developed lung parenchymal mast cells at an appreciable density.ConclusionOur observations support that environmental factors, possibly through modulation of microbiota, may impact the tissue distribution of mast cells in mouse lung parenchyma.

show abstract

Evidence of functional Cd94 polymorphism in a free-living house mouse population

Cited by 2 publications

References 55 publications

A Model System for Feralizing Laboratory Mice in Large Farmyard-Like Pens

A Model System for Feralizing Laboratory Mice in Large Farmyard-Like Pens

Mast Cells Are Identified in the Lung Parenchyma of Wild Mice, Which Can Be Recapitulated in Naturalized Laboratory Mice

Contact Info

Product

Resources

About