Exome sequencing identifies a novel nonsense mutation of HOXD13 in a Chinese family with synpolydactyly

Wang, Bo; Niu, Li; Geng, Juan; Wang, Zhigang; Fu, Qin; Wang, Jian; Xu, Yunlan

doi:10.1111/cga.12173

Cited by 6 publications

(3 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…5 Till date, 16 mutations in HOXD13 are known to cause SPD. 2,6 The most common variations among all known types of mutations in HOXD13 are 15-residue N-terminal polyalanine repeats. 7 In the present study, a novel frameshift variant, c.708_708delC in exon 1 of HOXD13 was identified.…”

Section: Discussionmentioning

confidence: 99%

Occurrence of Synpolydactyly and Omphalocele in a Fetus with a HOXD13 Mutation

et al. 2017

View full text Add to dashboard Cite

Synpolydactyly (SPD) is an autosomal dominant congenital limb disorder due to mutations in . It is a phenotypically heterogeneous condition characterized by syndactyly of the third finger (F3), fourth finger (F4) and/or fourth toe (T4), and fifth toe (T5) with variably associated polydactyly. We report on a mother and fetus with SPD. The mother has a novel mutation (c.708_708delC) in the gene that was also seen in the fetus. However, the fetus had congenital omphalocele in addition to SPD that is an association not reported to date. A chromosomal microarray in the fetus was normal. We report a novel mutation in and document co-occurrence of an omphalocele and SPD in a fetus.

show abstract

Section: Discussionmentioning

confidence: 99%

Occurrence of Synpolydactyly and Omphalocele in a Fetus with a HOXD13 Mutation

et al. 2017

View full text Add to dashboard Cite

show abstract

“…Several other different types of mutations had also been reported for SPD1 in HOXD13 , i.e. deletions [7, 23], nonsense mutations [8, 24, 25] and missense mutations [9, 10, 26–32], but most common amongst all was expansion of polyalanine repeats [2]. Therefore, polyalanine repeats in N-terminal region of HOXD13 is a mutational hot spot and mutation in this region will comes under category PM1 (moderate evidence of pathogenicity) according to classification of ACMG for classifying pathogenic variants [15].…”

Section: Discussionmentioning

confidence: 99%

A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family

Zaib¹,

Ji²,

Saleem³

et al. 2019

BMC Med Genet

View full text Add to dashboard Cite

BackgroundSynpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family.MethodsWe used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines.ResultsOur results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family.ConclusionBased on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

show abstract

“…In our own study, with the help of whole-genome sequencing (WGS), we identified a 24-base pair duplication variant, c.183_206dupGCGGCGGCTGCGGCGGCGGCGGC (Reference sequence: NM_000523.3) in HOXD13 that results in the addition of eight extra alanines in four generations of a family in northern China [82]. Similarly, missense and nonsense mutations in HOXD13 have also been reported in large families affected with SPD1 [83][84][85].…”

Section: Hoxd13 and Its Role In Causing Syndactylymentioning

confidence: 97%

Recent Advances in Syndactyly: Basis, Current Status and Future Perspectives

Zaib

Rashid

Khan

et al. 2022

Genes

View full text Add to dashboard Cite

A comprehensive summary of recent knowledge in syndactyly (SD) is important for understanding the genetic etiology of SD and disease management. Thus, this review article provides background information on SD, as well as insights into phenotypic and genetic heterogeneity, newly identified gene mutations in various SD types, the role of HOXD13 in limb deformities, and recently introduced modern surgical techniques for SD. This article also proposes a procedure for genetic analysis to obtain a clearer genotype–phenotype correlation for SD in the future. We briefly describe the classification of non-syndromic SD based on variable phenotypes to explain different phenotypic features and mutations in the various genes responsible for the pathogenesis of different types of SD. We describe how different types of mutation in HOXD13 cause various types of SD, and how a mutation in HOXD13 could affect its interaction with other genes, which may be one of the reasons behind the differential phenotypes and incomplete penetrance. Furthermore, we also discuss some recently introduced modern surgical techniques, such as free skin grafting, improved flap techniques, and dermal fat grafting in combination with the Z-method incision, which have been successfully practiced clinically with no post-operative complications.

show abstract

Exome sequencing identifies a novel nonsense mutation of HOXD13 in a Chinese family with synpolydactyly

Cited by 6 publications

References 21 publications

Occurrence of Synpolydactyly and Omphalocele in a Fetus with a HOXD13 Mutation

Occurrence of Synpolydactyly and Omphalocele in a Fetus with a HOXD13 Mutation

A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family

Recent Advances in Syndactyly: Basis, Current Status and Future Perspectives

Contact Info

Product

Resources

About