Exploiting the Natural Diversity in Adenovirus Tropism for Therapy and Prevention of Disease

Abstract

Since targeting of recombinant adenovirus vectors to defined cell types in vivo is a major challenge in gene therapy and vaccinology, we explored the natural diversity in human adenovirus tissue tropism. Hereto, we constructed a library of Ad5 vectors carrying fibers from other human serotypes. From this library, we identified vectors that efficiently infect human cells that are important for diverse gene therapy approaches and for induction of immunity. For several medical applications (prenatal diagnosis, artificial bone, vaccination, and cardiovascular disease), we demonstrate the applicability of these novel vectors. In addition, screening cell types derived from different species revealed that cellular receptors for human subgroup B adenoviruses are not conserved between rodents and primates. These results provide a rationale for utilizing elements of human adenovirus serotypes to generate chimeric vectors that improve our knowledge concerning adenovirus biology and widen the therapeutic window for vaccination and many different gene transfer applications.

Fiber-chimeric adenoviruses expressing fibers from serotype 16 and 50 improve gene transfer to human pancreatic adenocarcinoma

“…15 Fiber genes were PCR amplified with distinct sets of 'subgroup-specific' oligonucleotides, as described by Havenga et al 12 Subsequently, fiber sequences were cloned in an NdeI-and NsiI-digested pBr/Ad.BamRDFIB plasmid, thus generating a library of plasmids coded pBr/Ad.BamRDFIBXX, where 'XX' represents the serotype from which the fiber was amplified. Plasmid pBr/Ad.BamRDFIB has been described previously.…”

“…The number of genomic copies (gc) was determined by quantitative real-time PCR by using the primers against hexon DNA (forward: gacatgactttcgagctcgatcccatgga, reverse ccggccgagaagggtgtgcgcaggta. 20 The production yields of the viral batches (in gc per ml) were as follows: Ad5.GFP 5.7 Â 10e 12 , Ad5.-Fib16.GFP 5.0 Â 10e 12 and Ad5.Fib50.GFP 5.9 Â 10e 12 .…”

“…Therefore, fiber-chimeric adenoviruses in which the tropism is determined by the fiber of an alternative Ad serotype may enhance Ad entry into pancreatic cancer cells. 11,12 The backbone of Ad5 was used to ascertain the reproducible production of high titers. At present, 51 distinct serotypes have been recognized.…”

Transductional targeting of adenovirus vectors for gene therapy

“…cellular receptor other than CAR, was first accomplished by Krasnykh et al 64 These vectors display CARindependent tropism by virtue of the natural diversity in receptor recognition found in human subgroup B and D fibers. 65 In this regard, primary receptors for subgroup B Ads have been recently identified, including the complement regulatory protein CD46, [66][67][68][69] CD80 and CD86, 70 although an additional unknown receptor is postulated. 67 Subgroup D Ad receptors include CD46 and a(2-3)-linked sialic acid, a common element of glycolipids.…”

Partial protection against SIV challenge by vaccination of adenovirus and MVA vectors in rhesus monkeys

“…Some of the most important studies have been those involving vector-based vaccines that use adenovirus (Ad) and vaccinia vectors. Human Ad viruses are classified into six subgroups from A to F. 7 Most Ad serotypes belonging to subgroups A, C, D, E and F use the Coxsackievirus and adenovirus receptor (CAR) as a cellular receptor. 8 The Ad serum type 5 (Ad5, subgroup C) has well-defined biological properties and has been widely used as a vector in gene therapy and vaccine development.…”