Expression of serum response factor in the lung mesenchyme is essential for development of pulmonary fibrosis

Abstract

Extracellular matrix deposition characterizes idiopathic pulmonary fibrosis (IPF) and is orchestrated by myofibroblasts. The lung mesenchyme is an essential source of myofibroblasts in pulmonary fibrosis. While the transcription factor serum response factor (SRF) has shown to be critical in the process of myofibroblast differentiation, its role in development of pulmonary fibrosis has not been determined in vivo. In this study, we observed SRF expression localized to mesenchymal compartments, areas of dense fibrosis, and fibroblastic foci in human (IPF and normal) and bleomycin-treated mouse lungs. To determine the role of mesenchymal SRF in pulmonary fibrosis, we utilized a doxycycline inducible, Tbx4 lung enhancer (Tbx4LE) driven cre-recombinase to disrupt SRF expression in the lung mesenchyme in vivo. Doxycycline-treated Tbx4LE-rtTA/TetO-Cre/tdTom/SRFf,f (and controls) were treated with a single intratracheal dose of bleomycin to induce pulmonary fibrosis and examined for lung mesenchymal expansion, pulmonary fibrosis, and inflammatory response. Bleomycin-treated Tbx4LE-rtTA/TetO-Cre/tdTom/SRFf,f mice showed decreased numbers of Tbx4LE-positive lung mesenchymal cells (LMC) and collagen accumulation (via hydroxyproline assay) compared to controls. This effect was associated with SRF-null LMC losing their proliferative and myofibroblast differentiation potential compared to SRF-positive controls. Together, these data demonstrate that SRF plays a critical role in LMC myofibroblast expansion during bleomycin-induced pulmonary fibrosis. This sets the stage for pharmacologic strategies that specifically target SRF in the lung mesenchyme as a potential means of treating pulmonary fibrosis.

Selective Inhibition of Bromodomain-Containing Protein 4 Reduces Myofibroblast Transdifferentiation and Pulmonary Fibrosis

“…Mouse weight and survival after treatment were documented daily until endpoint on days 14, 21 or 28 post-bleomycin. Cages carrying five mice/cage were allocated to each group [one cage for NS-treated group and two cages for each of the bleomycin-treated groups to account for previously observed mortality rates post-bleomycin in C57Bl/6J females ( Bernau et al, 2015 ; Bernau et al, 2021 )]. Daily IP injections of ZL0591 (10 mg/kg body weight), or vehicle control, were administered to surviving mice from day 14 until 21 and every other day thereafter until endpoint at day 28.…”

“…Assessment of total lung collagen was performed by utilizing a colorimetric hydroxyproline assay, as we have previously done ( Bernau et al, 2021 ). Flash frozen superior, inferior and post-caval lobes of the right lung were homogenized in double distilled H 2 O (ddH 2 O, Sigma Aldrich, St. Louis, MO) using a dounce homogenizer.…”

“…Flash frozen middle lobes of the right lungs were homogenized using a bullet blender with RNA STAT-60 and 0.9–2.0 mm stainless steel RNase-free bullet blender beads before being subjected to the previously described RNA isolation protocol ( Bernau et al, 2015 ; Bernau et al, 2021 ). RNA was reverse transcribed using SuperScript IV (ThermoFisher Scientific), according to manufacturer’s instructions.…”

“…The reaction mixtures were subjected to 1 cycle of 2 m at 50°C; 1 cycle of 10 m at 95°C; 45 cycles of 15 s at 95°C, 1 m at 60°C using an AriaMx Realtime PCR System (Agilent Technologies, Santa Clara, CA). For assessment of Tenascin ( Tnc ) and Surfactant protein C ( Sftpc ), Glyceraldehyde 3-phosphate dehydrogenase ( Gapdh ) was utilized as a housekeeping gene, RNA was reverse transcribed using iScript cDNA synthesis kit (Bio-Rad, Hercules, CA) and RT-qPCR analysis was performed using iTaq SYBR Green supermix (Bio-Rad) in an Applied Biosystems 7,500 multicolor real-time PCR detection system (Applied Biosystems), as before ( Bernau et al, 2021 ). The following SYBR Green primer sequences were used: Tnc forward: ACC ATGCTGAGATAGATGTTCCAAA, Tnc reverse: CTTGAC AGCAGAAACACCAATCC; Sftpc forward: GTAGCAAAG AGGTCCTGATG, Sftpc reverse: CCTACAATCACCACGACAA; Gapdh forward: GCCCAAGATGCCCTTCAGTG, Gapdh reverse: CATCCACTGGTGCTGCCAAG.…”

“…Bronchoalveolar lavage (BAL) fluid was extracted from mouse lungs as before ( Bernau et al, 2015 ; Bernau et al, 2021 ). Following anesthetization and exsanguination, mice were intubated by inserting a catheter into the exposed trachea.…”