Expression of tmRNA in mycobacteria is increased by antimicrobial agents that target the ribosome

Abstract

The specialized RNA, tmRNA, is a central component of prokaryote trans-translation; a process that salvages stalled translational complexes. Evidence from other bacteria, suggested that exposure to ribosome inhibitors elevated tmRNA levels, although it was unclear whether such changes resulted from increased tmRNA synthesis. Consequently, this study was initiated to determine the effect of ribosome inhibitors on the expression tmRNA in mycobacteria. Exposure of Mycobacterium smegmatis to ribosome-targeting antimicrobial agents was associated with increased in the levels of the tmRNA precursor, pre-tmRNA, and mature tmRNA. For example, exposure to 16 μg mL−1 erythromycin for 3 h increased pre-tmRNA and tmRNA by 18 and 6-fold, respectively. Equivalent results were found following exposure of Mycobacterium bovis BCG to streptomycin. Exposure to antimicrobial agents with non-ribosome targets did not affect tmRNA levels. The increased tmRNA levels were associated with increased output from the ssrA promoter, which controls tmRNA transcription, without evidence of a change in tmRNA degradation. Thus, these results suggested that the upregulation of tmRNA expression was an important response of bacteria to exposure to ribosome-inhibiting antimicrobial agents.

Induced ectopic expression of HigB toxin in Mycobacterium tuberculosis results in growth inhibition, reduced abundance of a subset of mRNAs and cleavage of tmRNA

“…Quantification using primers directed to either the 5′ or the 3′ end of tmRNA revealed a 1.5-fold increase in relative expression after addition of ATc to the vector strain (Fig. 3 D middle and bottom), consistent with a previous observation that tetracycline upregulates expression of tmRNA in M. smegmatis (Andini and Nash, 2011 ). In contrast to this, the relative number of transcripts detected using the 5′ and 3′ probes in the expression strain dropped sharply over the 24 h incubation period (Fig.…”

Structures of Mycobacterium smegmatis 70S ribosomes in complex with HPF, tmRNA, and P-tRNA

“…To rescue these stalled ribosomes in bacteria a specialized RNA species, known as transfer-messenger RNA (tmRNA), binds to ribosome, rescues them from stalling and resumes translation 12 – 15 . Studies have corroborated the fact that trans-translation state of the ribosome in bacteria helps to overcome the effects of ribosome-targeting anti-microbial agents 13 , 16 . Unlike in Ec , the tmRNA encoding gene, ssrA is essential in M. tuberculosis ( Mtb ) 17 .…”

Ribosome Rescue Inhibitors Kill Actively Growing and Nonreplicating Persister Mycobacterium tuberculosis Cells

“…Primers to express the mature tmRNA were used for these studies. 41 tmRNA primer sequences were as follows: MSTSSRA-5 TGCAGGCAAGAGACCACCGTA; MTSSRA-6 CCGGTCACGCGAACTAGCCGAGA.…”