Expression patterns of microRNAs 155 and 451 during normal human erythropoiesis

Regulation of erythroid differentiation by miR-376a and its targets

“…Therefore, we explored whether an increase of miR-376a was able to disturb the expression of other endogenous miRNAs, such as miR-451, miR-144, miR-210, and miR-15a, through the down-regulation of Ago2. The first three of these selected miRNAs were previously experimentally validated as promoters of erythroid differentiation [13][14][15][16]. Indeed, the levels of miR-451, miR-144, and miR-210 were markedly reduced in premiR-376a-transfected K562 cells during hemin-induced erythroid differentiation ( Figure 4D-4F).…”

“…Furthermore, miR-376a expression was dramatically decreased in K562 cells and CD34+ HPCs during early erythroid dif- ferentiation, indicating that it may function as a negative regulator in this 'priming' process. Previous studies have reported a 'priming' state in the commitment process of HPCs to the erythroid lineage [13]. This priming state consists of various key events, such as the reprogramming of internal gene expression patterns and entrance into cell cycle.…”

“…Our results show that miR-376a, whose expression is limited to the early stages of erythroid differentiation, down-regulates Ago2 and CDK2, thereby inhibitting progenitor cell growth and differentiation. Several studies have reported a handful of miRNAs that are differentially expressed in CD34+ HPCs or K562 cells following the induction of erythroid differentiation, and that regulate erythroid differentiation through their target mRNAs, such as miR-221, miR-222 [12], miR-451, miR-144 [13][14][15], miR-210 [16], and let-7d [17], etc. However, miR376a was rarely mentioned in these studies.…”

“…Previously, several miRNAs have been identified as being involved in hematopoiesis through their target genes. For example, miR-223 enhances retinoic acid (RA)-induced granulocytic differentiation by targeting nuclear factor I/A (NFIA) [10]; miR-155 transduction greatly reduces both the myeloid and erythroid colony formation of normal human hematopoietic stem-progenitor cells [11]; miR-221 and miR-222 inhibit normal erythropoiesis and erythroleukemic cell growth via kit protein down-regulation [12]; miR-451 and GATA transcription factors were shown to comprise a regulatory circuit that modulates erythroid maturation [13][14][15] npg involved in increased expression of the γ-globin gene in differentiating erythroid cells [16]; and the up-regulation of the let-7 miRNA family in circulating erythroid cells is associated with the fetal-to-adult hemoglobin switching during human development [17]. Our previous work has identified two regulatory miRNAs, miR-223 and miR-103, that inhibit erythroid differentiation through targeting LIM domain only 2 (LMO2) [18,19] and forkhead box J2 (FoxJ2) [20], respectively.…”

Considering the effect of stem-loop reverse transcription and real-time PCR analysis of blood and saliva specific microRNA markers upon mixed body fluid stains

“…Body Fluid Mature Sequence (5'-3') Hsa-mir-451 [7,30] Blood aaaccguuaccauuacugaguu Hsa-mir-205 [7] Saliva uccuucauuccaccggagucug [25][26][27][28][29]. [29].…”