Expression, Regulation and Function of Human Metallothioneins in Endothelial Cells

Abstract

Metallothioneins (MTs) are small cysteine-rich proteins which are involved in e.g. metal homeostasis, metal detoxification and protection against oxidative stress. In addition, several MTs have been shown to regulate expression of proangiogenic growth factors like vascular endothelial growth factor. Detailed information about the expression and regulation of specific MT isoforms in endothelial cells (EC) is limited. We therefore performed extensive mRNA expression profiling of all known human MTs in EC. We found that the basal endothelial expression is restricted to MT1E, MT1X, MT2A, and MT3. Physiological activation of EC by exposure to serum increased the expression of MT1E and MT2A and induced the expression of MT1M. Furthermore, exposure to zinc or copper induced the expression of most MT1 isoforms, while hypoxia specifically increased the expression of MT1E, MT1M, MT1X, and MT3. Finally, knockdown of the dominant MT isoform in EC, i.e. MT2A, resulted in decreased proliferation and sprouting as well as in increased migration of human umbilical vein EC. Together, these findings provide a link between MTs and angiogenesis.

A bioengineered living cell construct activates metallothionein/zinc/MMP8 and inhibits TGFβ to stimulate remodeling of fibrotic venous leg ulcers

“…Metallothioneins act as modulators of local cellular zinc supply to regulate the activities of zinc‐dependent proteins, including matrix metalloproteinases (MMP) . Using QPCR for a panel of alternatively spliced metallothionein transcripts, we validated our microarray findings in an expanded pool of pre‐ and posttreatment VLU biopsies from eight control and eight BLCC‐treated subjects. We confirmed induction of MT1H , MT1X , and MT2A transcripts in the BLCC‐treated group (Figure A), which correlated with increased metallothionein protein expression in the VLU bed (Figure B and C).…”

“…For all QPCR validation studies, technical triplicates were included. Primer sequences for the panel of metallothionein transcripts were obtained from a previous publication . ARPC2 primer sequences were (5′ to 3′): Forward‐ TCCGGGACTACCTGCACTAC, Reverse‐ GGTTCAGCACCTTGAGGAAG.…”

Effects of Abies sibirica terpenes on cancer- and aging-associated pathways in human cells

“…In turn metallothioneins (e.g. MT1X) are induced during cellular stress response involved in detoxification of metal ions [47]. …”

Human Milk Fortification Increases Bnip3 Expression Associated With Intestinal Cell Death In Vitro

“…Bnip3 is a member of the Bcl-2 gene family and has been implicated in virtually all forms of programmed cell death (19,20). The prototypical family member, Bcl-2, plays a survival role and is localized to both the mitochondria and the endoplasmic reticulum, where it gates the inositol trisphosphate receptor (IP3-receptor) and prevents excessive calcium transfer to the mitochondria (21). We interpret our findings that Bnip3 overexpression increased cell death and that this effect was abolished by the Bnip3 exon 3 splice variant, to be confirmatory of the putative effect of the Bnip3 gene product on cell death, although we cannot say whether this is via apoptotic or necrotic pathways.…”