Flagellin Promotes Myeloid Differentiation Factor 88-Dependent Development of Th2-Type Response

Didierlaurent, Arnaud M.; Ferrero, Isabel; Otten, L.; Dubois, Bertrand; Reinhardt, Monique; Carlsen, Harald; Blomhoff, Rune; Akira, S.; Kraehenbuhl, Jean–Pierre; Sirard, Jean‐Claude

doi:10.4049/jimmunol.172.11.6922

Cited by 283 publications

(247 citation statements)

References 48 publications

Supporting

Mentioning

225

Contrasting

Unclassified

Order By: Relevance

“…In contrast, flagellin may directly activate lung dendritic cells [48,56]. In systemic activation, dendritic cells are directly activated by flagellin in a MyD88-dependent manner [41,42] and this maturation is crucial for initiation of cellular and humoral adaptive immunity [57].…”

Section: Discussionmentioning

confidence: 99%

“…Flagellin administration and measurement of respiratory function LPS-depleted flagellin FliC from S. enterica Serovar Typhimurium (1 mg) produced as described previously [56], LPS (10 mg) from E. coli (serotype 055: B5, Sigma St Louis, MO, USA) or saline were given by the aerogenic route using nasal instillation in a volume of 40 mL under light ketamine-xylazine anesthesia. The LPS concentration contamination as determined using the Limulus assay (Associates of Cape Cod, USA) was less than 10 pg LPS per mg of FliC.…”

Section: Methodsmentioning

confidence: 99%

“…The specific primers are CGTCATCCATGGCGAACTG/GCTTCTTTGCAGCTCCTTCGT (Actb coding b-actin), CTTGGTTCAGAAAATTGTCCAAAA/CAGGTGC-CATCAGAGCAGTCT (Cxcl1), TGGATCCAGAAGCTCCTGT GA/ATTCCGCTTAGCTTTCTTTTTGTC (Cxcl5), CATCTTCTCAA AATTCGAGTGACAA/CCTCCACTTGGTGGTTTGCT (Tnf) and GTTCTCTGGGAAATCGTGGAAA/AAGTGCATCATCGTTGTTCA-TACA (Il6). Relative mRNA levels (2 ÀDDCt ) were determined by comparing (i) the PCR cycle thresholds (Ct) for the gene of interest and Actb (DCt) and (ii) DCt values for treated and reference group (DDCt), as described previously [56].…”

Section: Cytokine Gene Expressionmentioning

confidence: 99%

See 2 more Smart Citations

Radioresistant cells expressing TLR5 control the respiratory epithelium's innate immune responses to flagellin

et al. 2009

Self Cite

View full text Add to dashboard Cite

Bacterial products (such as endotoxins and flagellin) trigger innate immune responses through TLRs. Flagellin-induced signalling involves TLR5 and MyD88 and, according to some reports, TLR4. Whereas epithelial and dendritic cells are stimulated by flagellin in vitro, the cell contribution to the in vivo response is still unclear. Here, we studied the respective roles of radioresistant and radiosensitive cells in flagellin-induced airway inflammation in mice. We found that i.n. delivery of flagellin elicits a transient change in respiratory function and an acute, pro-inflammatory response in the lungs, characterized by TLR5-and MyD88-dependent chemokine secretion and neutrophil recruitment. In contrast, TLR4, CD14 and TRIF were not essential for flagellin-mediated responses, indicating that TLR4 does not cooperate with TLR5 in the lungs. Respiratory function, chemokine secretion and airway infiltration by neutrophils were dependent on radioresistant, TLR5-expressing cells. Furthermore, lung haematopoietic cells also responded to flagellin by activating TNF-a production. We suggest that the radioresistant lung epithelial cells are essential for initiating early, TLR5-dependent signalling in response to flagellin and thus triggering the lung's innate immune responses.Key words: Chemokine . Epithelium . Flagellin . Lung inflammation . TLR5 IntroductionUpon challenge with respiratory pathogens, the airways rapidly develop a pro-inflammatory response initiated by environmental agents including microbe-associated molecular patterns such as Gram-negative bacteria LPS or endotoxins. This proinflammatory reaction plays an important role in the innate defense against respiratory pathogens [1,2]. Physiological changes induced by endotoxin inhalation include pulmonary Ã These authors contributed equally to this work. Eur. J. Immunol. 2009. 39: 1587-1596 DOI 10.1002 Innate immunity 1587 function and bronchoconstriction, cytokine and chemokine production, PMN recruitment, increased permeability of the alveolar epithelium and the associated endothelium [3][4][5][6]. TLR4 [7], together with MD-2, LPS-binding protein and CD14 detect endotoxins and play a critical role in the initiation of the pulmonary response to systemic and mucosal endotoxin administration [5,[8][9][10]. The pulmonary inflammation to endotoxin involves TLR4 signalling in both the parenchyma cells like endothelial and epithelial cells and the haematopoietic cells, i.e. monocytes, dendritic cells and neutrophils [11]. In addition, TLR4 signalling contributes to the development and progression of chronic respiratory disease including asthma [12][13][14][15][16].Flagellin is the major constituent of flagella from Gramnegative and Gram-positive bacteria. TLR5 has been identified as the main pattern recognition receptor required for flagellinmediated immune signalling [17]. TLR5 signalling depends on MyD88 and results in activation of MAPK, nuclear translocation of NF-kB and production of various pro-inflammatory cytokines and chemokines [18]. Moreover, a previous ...

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Cytokine Gene Expressionmentioning

confidence: 99%

See 1 more Smart Citation

Radioresistant cells expressing TLR5 control the respiratory epithelium's innate immune responses to flagellin

et al. 2009

Self Cite

View full text Add to dashboard Cite

show abstract

“…These mucosal adjuvant properties correlate with the capacity of flagellin to activate TLR5-positive DCs and/or epithelial cells [23,71,73]. Flagellin triggers a Th2-response [23,71,72,74] with the production of mucosal IgAs [23,71,72,74].…”

Section: Airways Response To Flagellated Bacteriamentioning

confidence: 93%

“…1B) [12,13,23]. TLR5 signalling activates nuclear factor (NF)-kB and mitogen-activated protein kinase (MAPK) pathways, i.e.…”

Section: Molecular Features Of Flagellin Detection By Tlr5mentioning

confidence: 99%

Mucosal interplay among commensal and pathogenic bacteria: Lessons from flagellin and Toll‐like receptor 5

Rumbo

Nempont

Kraehenbuhl³

et al. 2006

FEBS Letters

Self Cite

View full text Add to dashboard Cite

Toll‐like receptors (TLR) detect pathogen‐associated molecular patterns (PAMP) and play a crucial role in triggering immunity. Due to their large surfaces in direct contact with the environment, mucosal tissues are the major sites of PAMP‐TLR signalling. How innate and adaptive immunity are triggered through flagellin–TLR5 interaction is the main focus of the review. In view of recent reports on genetic polymorphism, we will summarize the impact of TLR5 on the susceptibility to mucosal infections and on various immuno‐pathologies. Finally, the contribution of TLRs in the induction and maintenance of mucosal homeostasis and commensal discrimination is discussed.

show abstract

Microbial Instruction of Dendritic Cells

Jong¹,

Smits²,

Wierenga³

et al. 2006

Handbook of Dendritic Cells

View full text Add to dashboard Cite

Flagellin Promotes Myeloid Differentiation Factor 88-Dependent Development of Th2-Type Response

Cited by 283 publications

References 48 publications

Radioresistant cells expressing TLR5 control the respiratory epithelium's innate immune responses to flagellin

Radioresistant cells expressing TLR5 control the respiratory epithelium's innate immune responses to flagellin

Mucosal interplay among commensal and pathogenic bacteria: Lessons from flagellin and Toll‐like receptor 5

Microbial Instruction of Dendritic Cells

Contact Info

Product

Resources

About