Forced cell cycle exit and modulation of GABA_A, CREB, and GSK3β signaling promote functional maturation of induced pluripotent stem cell-derived neurons

Abstract

Although numerous protocols have been developed for differentiation of neurons from a variety of pluripotent stem cells, most have concentrated on being able to specify effectively appropriate neuronal subtypes and few have been designed to enhance or accelerate functional maturity. Of those that have, most employ time courses of functional maturation that are rather protracted, and none have fully characterized all aspects of neuronal function, from spontaneous action potential generation through to postsynaptic receptor maturation. Here, we describe a simple protocol that employs the sequential addition of just two supplemented media that have been formulated to separate the two key phases of neural differentiation, the neurogenesis and synaptogenesis, each characterized by different signaling requirements. Employing these media, this new protocol synchronized neurogenesis and enhanced the rate of maturation of pluripotent stem cell-derived neural precursors. Neurons differentiated using this protocol exhibited large cell capacitance with relatively hyperpolarized resting membrane potentials; moreover, they exhibited augmented: 1) spontaneous electrical activity; 2) regenerative induced action potential train activity; 3) Na(+) current availability, and 4) synaptic currents. This was accomplished by rapid and uniform development of a mature, inhibitory GABAAreceptor phenotype that was demonstrated by Ca(2+) imaging and the ability of GABAAreceptor blockers to evoke seizurogenic network activity in multielectrode array recordings. Furthermore, since this protocol can exploit expanded and frozen prepatterned neural progenitors to deliver mature neurons within 21 days, it is both scalable and transferable to high-throughput platforms for the use in functional screens.

Kv7 channels are upregulated during striatal neuron development and promote maturation of human iPSC-derived neurons

“…Therefore, using the hiPSCs pre-patterned by an established technique of dual SMAD and Wnt inhibition [20, 26, 37], a detailed determination of both the expression of KCNQ mRNA and Kv7 subunits in these developing striatal-like neurons was performed using the control hiPSC line, CS83iCTR33Qn1 (CTR33Qn1). KCNQ2 and KCNQ5 mRNA both increased early (23 dpp), whilst KCNQ3 and KCNQ4 showed no significant differences during the differentiation protocol.…”

“…In these experiments, we measured the individual Vm values and ongoing electrical activity. For the latter, we classified hiPSC-derived neurons in the same way we did in the previous study [37] as showing absence of any activity (‘Quiet’), only sub-threshold transient depolarizing events (‘Attempting’ activity) and activity with overshooting action potentials (true ‘Spontaneous’ activity, Fig. 6a).…”

Developmental alterations in Huntington's disease neural cells and pharmacological rescue in cells and mice

“…Neural cultures were generated from iPSC monolayer grown on Matrigel-coated six-well plates, using a 37-d protocol 79 HTT knockdown was achieved by supplementation of the culture medium with HTT-specific (TCTCTATTGCACATTCCA) or control (CCTTCCCTGAAGGTTCCTCC) ASO 15 such that neurons received four doses of 1 μM ASO over 7 d immediately before harvest at day 37. Total RNA was isolated from two wells each of untreated, control-ASO-treated and HTT-ASO-treated neural differentiation with TRIzol and 400 ng of RNA used for RT-PCR, with three technical replicates performed for each gene.…”

Chronically stressed or stress-preconditioned neurons fail to maintain stress granule assembly

“…Cells were differentiated into motor neurons using published protocols 51, 52 with modifications. Briefly, confluent hES H9 cell cultures were switched to differentiation medium of the following composition: advanced DMEM/F12 (ADF) supplemented with GlutaMAX, penicillin-streptomycin (all Gibco, Grand Island, NY, USA) and SB431542 (10  μ M, Abcam, Bristol, UK).…”