FTX271: A potential gene resource for plant antiviral transgenic breeding

Abstract

Flammutoxin (FTX), as well as its precursor TDP, is a protein from Flammulina velutipes with antiviral activity. Transgenic tobacco with the FTX271 (gene of FTX or TDP) can not only delay the onset time of symptoms but also alleviate the symptoms caused by tobacco mosaic virus (TMV), but the mechanism is still unclear. In this study, FTX271 was introduced into Nicotiana benthamiana, and the disease resistance mechanism activated by FTX271 was speculated by transcriptomic and proteomic techniques. The results showed that TDP was detected, and some genes, proteins and pathways were significant upregulated or enriched in transgenic tobacco, including the mitogen-activated protein kinase (MAPK) cascade signal transduction pathway, the expression of hypersensitive response (HR) marker genes H1N1 and HSR203J, pathogenesis-related (PR) genes, and the key genes COI1 and lipoxygenase gene LOX2 of the jasmonic acid (JA) signaling pathway, indicating FTX271 may activate the MAPK pathway and increase the content of reactive oxygen species (ROS) and JA, which promoted the HR and inducible systemic resistance (ISR). ISR caused increased expression of peroxidase (POD) and other proteins involved in pathogen defense. In addition, transgenic tobacco may use sHSP-assisted photoreparation to alleviate the symptoms of TMV. In conclusion, JA-mediated ISR and sHSP-assisted photoreparation are activated by FTX271 to protect tobacco from TMV infection and alleviate the symptoms caused by the virus. The study provided a theoretical basis for the TMV resistance mechanism of FTX271, which may represent a potential gene resource for plant antiviral transgenic breeding.

Flammutoxin, a Degradation Product of Transepithelial Electrical Resistance-Decreasing Protein, Induces Reactive Oxygen Species and Apoptosis in HepG2 Cells

“…BAA76510.1) was one of the main proteins in Ffsp-50 . TDP was the precursor of or identical to FTX [ 27 ], which could produce multiple FTX family proteins by partial C-terminal truncation [ 28 ]. Therefore, these findings suggested that FTX was the dominating protein in the different protein fractions except for Ffsp-90 .…”

Discovery of Novel Pyridazine Herbicides Targeting Phytoene Desaturase with Scaffold Hopping

“…Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using the TB Green Premix Ex TapTM II kit (TaKaRa, China) and a CFX96 system (Bio-Rad, USA) under the conditions described in the reagent’s instructions. The primers of the PDS gene are Nb PDSb-F: CGACCAGGTAGCAGCCTATG, Nb PDSb-R: TGGCAGGACCAACAAATGGT, and those of the actin gene are Nb Actin-F: CCTGAGGTCCTTTTCCAACCA and Nb Actin-R: GGATTCCGGCAGCTTCCATT . Three replicates were performed for each biological sample.…”

“…The primers of the PDS gene are NbPDSb-F: CGACCAGGTAGCAGCCTATG, NbPDSb-R: TGGCAGGAC-CAACAAATGGT, and those of the actin gene are NbActin-F: CCTGAGGTCCTTTTCCAACCA and NbActin-R: GGATTCCGG-CAGCTTCCATT. 38 Three replicates were performed for each biological sample.…”