Ganoderma lucidum cultivation affect microbial community structure of soil, wood segments and tree roots

Abstract

The popular medicinal mushroom Ganoderma lucidum (Fr.) Karst. [Ling Zhi] has been widely used for the general promotion of health and longevity in Asian countries. Continuous cultivation may affect soil microbe and soil properties. However, the effect of G. lucidum cultivation on related wood segments, soil and tree roots microbial communities and soil properties is remain unknown. In our study, the microbial communities of soils, wood segments, and tree roots before and after G. lucidum cultivation were investigated by Illumina Miseq sequencing of both ITS and 16S rDNA, and taxonomic composition of eukaryotic and prokaryotic microorganisms were observed. Indices of microbial richness, diversity and evenness significantly differed between before and after G. lucidum cultivation. Each of the investigated sampling type harbored a distinctive microbial community and differed remarkably before and after G. lucidum cultivation. Ascomycota and Basidiomycota (fungi), Proteobacteria and Actinobacteria (bacteria) showed significant differences after Ling Zhi cultivation. The soil property values also changed after cultivation. The redundancy analysis (RDA) showed that both the fungal and bacterial community structure significantly correlated with soil humus, pH, nitrogen, carbon and trace elements (Fe, Zn, Mn, Cu) contents. The results indicated that G. lucidum cultivation may have significant differed the associated microbial community structures and soil properties. The study will provide useful information for G. lucidum cultivation and under-forest economic development.

Bacterial and fungal communities of traditional fermented Chinese soybean paste (Doujiang) and their properties

“…The bacterial V3-V4 region of 16S rRNA gene was amplified with the primers 338F (ACTCCTACGGGAGGCAGCA) and 806R (GGACTACHVGGGTWTCTAAT) (Ren et al, 2020). ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATC GATGC) were used to amplify fungal ITS1 region (Costa et al, 2021;White et al 1990).…”

Mixed organic and inorganic amendments enhance soil microbial interactions and environmental stress resistance of Tibetan barley on plateau farmland

“…Fungi were possibly impacted by the presence of TOC and trace metal elements in fertilizer. It was reported that bacterial metabolism altered nitrogen-phosphorus synergy while percentage of fungi increase with higher of organic carbon content [50,51].…”

Bacterial Community Shifts in Casing Soil Before and After the Cultivation of Oudemansiella raphanipes

“…In this study, alpha diversity indices of bacterial community decreased after the cultivation of O. raphanipes, which may be due to the consumption of soil nutrient and the increase of secondary metabolites produced by fruiting bodies. The decrease of bacterial community diversity in casing soil is recognized as an important factor for the occurrence of continuous cropping obstacle of edible fungi (Ke et al 2019;Ren et al 2020) or other crops (Wang et al 2019). Therefore, it is very important to maintain high diversity coupling with functional redundancy of bacterial community for the healthy growth and high yield of edible fungi and other crops.…”