Gene Expression Modulation of Two Biosynthesis Pathways via Signal Transduction in <i>Cochliobolus heterostrophus</i>

Abstract

G-protein-linked pathways have evolved to allow responses to extracellular agonists (hormones, neurotransmitters, odors, chemoattractants, light and nutrients) in eukaryotic cells, ranging from simpler systems, including yeasts, filamentous fungi and slime molds, to more complex organisms, such as mammals. Although the role of G-protein and mitogen-activated protein kinase (MAPK) in filamentous fungi has been studied for over a decade, downstream elements are less known, and the study of target genes has evolved mainly in recent years. Here, we examined the involvement of G-protein subunits and MAPK in controlling the expression of two distinct target genes. These genes were selected from an array database according to their unique expression profile and the role of closely related genes found in other Ascomycetes. One of these genes is BPH, which encodes the enzyme responsible for cytochrome P450-dependent benzoate hydroxylation in microsomes. The other gene is CIPA, which encodes isoflavone reductase (IfR), an enzyme involved in the synthesis of phytoalexin, which catalyzes an intermediate step in pisatin biosynthesis. The expression profile of these two genes was determined in a series of signaling deficiency mutants that were grown on different media using a DNA microarray. Comparison of the expression profile in the two wild type strains and mutants deficient in the G-protein α or β subunits or in MAPK, revealed a unique control mechanism for the BPH and CIPA genes. The two genes are highly expressed during the infection of the host plant leaves and may associate with the fungal response to the host. Signaling via G-protein or MAPK was shown to be related to cascades that altered the expression of these genes in response to the growth condition. This work demonstrates that signal transduction pathways are controlling genes that, although sharing an environmental dependent response, participate in distinct biosynthesis pathways. Moreover, the transcriptional profile may point to distinct and shared roles of the signaling components.O. Degani 341

Genomic and Transcriptomic Study for Screening Genes Involved in the Limonene Biotransformation of Penicillium digitatum DSM 62840

“…Benzoate is essential for the metabolism pathways of aromatic compounds, and could inhibit fungal growth. It is reported that benzoate 4-monooxygenase gene from Cochliobolus heterostrophus was up-regulated after the infection of maize, and this demonstrated that benzoate detoxification in plant pathogenic fungi contributed to their pathogenicity (Degani, 2014). In addition, the proteomic studies showed a significant rise in PDIDSM_62110 with limonene treatment, which was in agreement with the findings of the transcriptome data.…”

Genome Assembly of the Fungus Cochliobolus miyabeanus, and Transcriptome Analysis during Early Stages of Infection on American Wildrice (Zizania palustris L.)

“…A putative ortholog, BPH , from C . heterostrophus was upregulated during maize infection, suggesting that maize defenses could involve benzoate biosynthesis in [ 114 ]. In C .…”

Cochliobolus heterostrophus T-toxin gene expression modulation via G protein and MAPK pathways

“…WT and signalling mutants were grown on different liquid media: complete medium with xylose (CMX, 48 h) or maltose (CMM, 48 h), minimal medium with xylose (MMX, 72 h), and also inoculated on maize cv. Grand Jubilee (Pop Vriend Seeds B.V., Andijk, the Netherlands, supplied by Eden Seeds, Reut, Israel) plants (as described previously Lev & Horwitz (2003) and Degani (2014b)). The intact leaves of the plants were dipped into homogenised mycelial suspension in order to obtain widespread lesions.…”

“…As a control for normalization of RNA expression levels, we hybridised blots with an oligonucleotide probe complementary to the A GAPDH housekeeping gene (encoding glyceraldehyde-3-phosphate dehydrogenase), according to Lev and Horwitz (2003) and Degani (2014b). A GAPDH fragment generated by PCR with primers 5' CCCTCGCCTGACGCCCCCAT 3' and 5' CGAGGACACGGCGGGAGTAA 3' was used to quantify fungal RNA.…”

“…However, we were allowed to search the array and publish several scoring results. This includes the C. heterostrophus Tox1B genes (DEC1 and RED1) described here and two other genes (BPH and CIPA) that have already been published elsewhere (Degani 2014b). The search was done using the BLASTN 2.2.6 program (Altschul et al 1997).…”