Genomic diversity and molecular differentiation ofRiemerella anatipestiferassociated with eight outbreaks in five farms

Abstract

Riemerella anatipestifer causes infectious serositis of ducks and geese. The genomic diversity of R. anatipestifer associated with outbreaks in waterfowls was studied using 24 multidrug-resistant R. anatipestifer isolates collected from the visceral organs of ducks and geese from seven outbreaks in four goose farms and one outbreak in one duck farm. Seven methods were used to differentiate these isolates. Plasmid patterns differed in plasmid number and size, ranging from 2.9 kb to 20 kb, and provided seven profiles. Divergent nucleotide sequences (predominant in 670 to 830 base pairs) of the ompA gene categorized the 24 isolates into three groups based on cluster analysis and polymerase chain reactionÁ restriction fragment length polymorphism. Repetitive-sequence polymerase chain reaction and pulsed-field gel electrophoresis analysis revealed the highest genotypic variations among the isolates. Genotypes and serotypes differed among farms and within the same farm and even within a single goose. In conclusion, a difference in R. anatipestifer genotypes and serotypes was observed for multiple outbreaks in waterfowls.

Prevalence and molecular characterization of chloramphenicol resistance inRiemerella anatipestiferisolated from ducks and geese in Taiwan

“…Antibiotic resistance can lead to the failure of disease treatments. There are studies that have reported chloramphenicol resistance in R. anatipestifer (Yu et al, 2008;Zhong et al, 2009). Since R. anatipestifer causes a severe disease in the form of septicaemia and serositis in ducks and geese, it is important to determine which factors play a major role in antibiotic resistance.…”

Outer Membrane Protein A Gene Based Diagnosis of Riemerella anatipestifer Infections in Ducks

“…The comparison of sequence of KML-1, KML-2 and KML-3 with the database sequence showed that most of sequence variations were seen in the region of 45 to 200 bp unlike the previous reports where the variations were mainly concentrated around 600-830bp region (Tsai et al, 2005;Yu et al, 2008). The aminoacid sequences derived from the nucleotide sequences were blasted using NCBI BLAST tool which showed 91-97% similarity to ompA protein of R. anatipestifer.…”

“…In all the isolates, amplicons of size of about 1100 bp were observed in 1.5 % agarose gel using 100 bp plus molecular size marker as a standard. Yu et al (2008) brane protein (ompA) using the same primer. The amplicons were cloned in T/A vector and sequenced and the interpretation of results provided about 1100 bp long sequences.…”

“…The unscrupulous use of antibiotics to control the disease has fastened the emergence of drug resistant strains (Chen et al, 2010(Chen et al, , 2012. Such divergence in genetic make-up results in limited cross protection between different R. anatipestifer strains and variations in virulence factors leading to mixed infection with multiple serotypes of the organism in the same bird (Subramaniam et al, 2000;Huang et al, 2002;Yu et al, 2008). Virulence and pathogenicity as assessed by morbidity and mortality rates varies with the serotype involved (Subramaniam et al, 2000).…”

“…The oligonucleotides OMP-F (5´AT-GTTGATGACTGGACTTGGTCT3´) and OMP-R (5´CTTCACTACTGGAAGGTCAGACTT3´) (Yu et al, 2008) were used in a 25 μl reaction mixture containing 20 picomoles of each primer, 200 μmol l -1 each of dATP, dCTP, dGTP, and dTTP; 1.5 mmol l -1 MgCl2; and 1 U of Taq DNA polymerase (Genei, Bangalore). The thermal cycling profile consisted of denaturation at 94 °C for 1 min, annealing at 54 °C for 1 min, and extension at 72 °C for 1 min for 35 cycles followed by a final extension at 72 °C for 3 min.…”