Gentamicin and Other Cassettes for Chromosomal Gene Replacement in
            <i>Escherichia Coli</i>

Poteete, Anthony R.; Rosadini, Charles V.; Pierre, Christine St.

doi:10.2144/000112242

Cited by 23 publications

(15 citation statements)

References 13 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We engineered a series of modification cassettes that allow the construction of epitope tags and gene deletions. These cassettes contain a gentamycin resistance marker derived from a bacterial transposon (Poteete et al, 2006) for selection in bacteria and chloramphenicol or phleomycin markers for the subsequent selection in T. gondii . We selected a suitable cosmid covering the TgAPT gene (PSBYL85), introduced this into the EL250 strain of E. coli and transiently induced the recombination machinery by heat shock.…”

Section: Resultsmentioning

confidence: 99%

The Toxoplasma Apicoplast Phosphate Translocator Links Cytosolic and Apicoplast Metabolism and Is Essential for Parasite Survival

Brooks

Johnsen

Dooren

et al. 2010

Cell Host & Microbe

127

154

View full text Add to dashboard Cite

Summary Apicomplexa are unicellular eukaryotic pathogens and cause important diseases including malaria and toxoplasmosis. The discovery of an algal endosymbiont, the apicoplast, provides exciting avenues to develop urgently needed new drugs. However, the physiological function of the apicoplast and its integration into the parasite metabolism remain poorly understood and at times controversial. Using a new approach to genetic engineering in Toxoplasma we show here that the apicoplast phosphate translocator (TgAPT) is an essential link between endosymbiont and cytoplasmic metabolism. Our genetic analyses show that TgAPT is required for fatty acid synthesis in the apicoplast, but indicate also that this might not be its most critical function. Detailed biochemical analyses demonstrate that this transporter has unique properties allowing it to supply the apicoplast with carbon, and indirectly with energy and reduction power. Ablation of the transporter results in remarkably strong and fast inhibition of parasite growth underscoring its merit as a target.

show abstract

Section: Resultsmentioning

confidence: 99%

The Toxoplasma Apicoplast Phosphate Translocator Links Cytosolic and Apicoplast Metabolism and Is Essential for Parasite Survival

Brooks

Johnsen

Dooren

et al. 2010

Cell Host & Microbe

127

154

View full text Add to dashboard Cite

show abstract

“…TP850, an otherwise isogenic strain lacking pae function, was described previously (Poteete et al ., 2004). The gam‐bet‐exo genes were replaced by aacC1 in strain TP1025, which was constructed by electroporation of TP848 with a linear dsDNA generated by PCR of strain TP997 (Poteete et al ., 2006) with primers GATAACAATTTCACACAGGAAACAGTCGACGCTTATAAAAATGTTACGCAGCAGCAACGA and ATCGGCCCATGGAGATCTTTGCGCCTACCCGGATATTATCTTAGGTGGCGGTACTTGGGT, followed by selection of recombinants with gentamicin.…”

Section: Methodsmentioning

confidence: 99%

Involvement of DNA replication in phage lambda Red‐mediated homologous recombination

Poteete¹

2008

Molecular Microbiology

Self Cite

View full text Add to dashboard Cite

SummaryCrosses between a non-replicating linear bacteriophage lambda chromosome and a replicating plasmid bearing a short cloned segment of lambda DNA were monitored by extracting DNA from infected cells, and analysing it via restriction endonuclease digestion and Southern blots. Recombinant formation resulting from the action of the Red homologous recombination system, observed directly in this way, was found to be fast, efficient, independent of the bacterial recA function and highly dependent upon replication of the target plasmid. These features of the experimental system faithfully model Red-mediated recombination in a lytically infected cell in which phage DNA replication is occurring. Neither of the previously established mechanisms by which the Red system can operate -strand annealing or strand invasionaccounts well for these findings. A third mechanism, replisome invasion, involving replication directly in the recombination mechanism, is invoked as an alternative.

show abstract

“…Therefore, recombinants often arise after only 16 h (overnight) incubation at 35°C. This incubation period is similar to other gene cassettes that select for chloramphenicol resistance or gentamycin resistance (30,36) but those markers are incapable of providing counter-selection. Finally, when creating mutants to study gene regulation or other aspects of E. coli physiology, the tolC strategy does not require antibiotics or specialized media that might interfere with facile experimental design or data interpretation (see subsequently).…”

Section: Discussionmentioning

confidence: 81%

Recombineering with tolC as a Selectable/Counter-selectable Marker: remodeling the rRNA Operons of Escherichia coli

DeVito

2007

Nucleic Acids Research

View full text Add to dashboard Cite

This work describes the novel use of tolC as a selectable/counter-selectable marker for the facile modification of DNA in Escherichia coli. Expression of TolC (an outer membrane protein) confers relative resistance to toxic small molecules, while its absence renders the cell tolerant to colicin E1. These features, coupled with the λredgam recombination system, allow for selection of tolC insertions/deletions anywhere on the E. coli chromosome or on plasmid DNA. This methodology obviates the need for minimal growth media, specialized wash protocols and the lengthy incubation times required by other published recombineering methods. As a rigorous test of the TolC selection system, six out of seven 23S rRNA genes were consecutively and seamlessly removed from the E. coli chromosome without affecting expression of neighboring genes within the complex rrn operons. The resulting plasmid-free strain retains one 23S rRNA gene (rrlC) in its natural location on the chromosome and is the first mutant of its kind. These new rRNA mutants will be useful in the study of rRNA gene regulation and ribosome function. Given its high efficiency, low background and facility in rich media, tolC selection is a broadly applicable method for the modification of DNA by recombineering.

show abstract

Gentamicin and Other Cassettes for Chromosomal Gene Replacement in Escherichia Coli

Cited by 23 publications

References 13 publications

The Toxoplasma Apicoplast Phosphate Translocator Links Cytosolic and Apicoplast Metabolism and Is Essential for Parasite Survival

The Toxoplasma Apicoplast Phosphate Translocator Links Cytosolic and Apicoplast Metabolism and Is Essential for Parasite Survival

Involvement of DNA replication in phage lambda Red‐mediated homologous recombination

Recombineering with tolC as a Selectable/Counter-selectable Marker: remodeling the rRNA Operons of Escherichia coli

Contact Info

Product

Resources

About