Glass Surfaces Grafted with High-Density Poly(ethylene glycol) as Substrates for DNA Oligonucleotide Microarrays

Abstract

Surfaces carrying a dense layer of poly(ethylene glycol) (PEG) were prepared, characterized, and tested as substrates for DNA oligonucleotide microarrays. PEG bis(amine) with a molecular weight of 2000 was grafted onto silanized glass slides bearing aldehyde groups. After grafting, the terminal amino groups of the PEG layer were derivatized with the heterobifunctional cross-linker succinimidyl 4-[p-maleimidophenyl]butyrate to permit the immobilization of thiol-modified DNA oligonucleotides. The stepwise chemical modification was validated with X-ray photoelectron spectroscopy. Goniometry indicated that the PEG grafting procedure reduced surface inhomogeneities present after the silanization step, while atomic force microscopy and ellipsometry confirmed that the PEG layer was dense and monomolecular. Hybridization assays using DNA oligonucleotides and fluorescence imaging showed that PEG grafting improved the yield in hybridization 4-fold compared to non-PEGylated maleimide-derivatized surfaces. In addition, the PEG layer reduced the nonspecific adsorption of DNA by a factor of up to 13, demonstrating that surfaces with a dense PEG layer represent suitable substrates for DNA oligonucleotide microarrays.

RNA expression profiling at the single molecule level

“…All images were recorded with a pixel size of 200 nm, which yields best performance for single-molecule identification at the given optical resolution limit of 450 nm (full width at half maximum of the point spread function); 40 min scanning time was required to record an area of 1 cm 2 on the chip surface. To enable imaging at high-detection efficiency, DNA microarrays were established on the basis of 150-µm thick aldehyde-functionalized glass coverslips, which were selected for low autofluorescence (Schlapak et al 2005).…”

“…For evaluation of sensitivity and dynamic range, probe oligonucleotide ([NH2-C12]ATAGAAATGCA GCGTGGATCTCTTAGCAGATTGAAACCGAGCTGTAGC GCTTGTGCCACC) (VBC-Genomics) and control oligonucleotides with a sequence identical to the target ([NH2-C12] GGTG GCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGAT CCACGCTGCATTTCTAT) were spotted with a MicroGridII arrayer (Genomic Solutions) using Stealth SMP3 Microarray Spotting Pins (TeleChem International, Inc.) onto 150-µm aldehyde coated coverslips (Schlapak et al 2005).…”

Surface-modified complex SU-8 microstructures for indirect optical manipulation of single cells

“…The rinsed and dried structures were then treated with PEG-diamine of MW 2000 dissolved in methanol (15 mM) [39]; this length have been shown to resist nonspecific biomolecule adsorption [40,41]. Then the slides were incubated on a hot plate for 20 mins at 60 °C, cooled to RT, rinsed in ultrapure water thoroughly and finally dried under a stream of nitrogen.…”

Modification of glassy carbon electrode by the electrochemical oxidation of 3‐aminophenylcalix[4]pyrrole in nonaqueous media

“…The corresponding high hysteresis value was 37 ± 0.8, implying that 3APCP film reduced the surface homogeneities of the underlying GC surface. [28] It is possible that the high hysteresis value is due to the numerous, irregular, elevated nanoscale features seen in AFM micrographs of GC-3APCP surface (Fig. 6(b)).…”