Halorubrum arcis sp. nov., an extremely halophilic archaeon isolated from a saline lake on the Qinghai–Tibet Plateau, China

Abstract

A Gram-negative, aerobic, neutrophilic and extremely halophilic archaeon (strain AJ201 T ), isolated from Ayakekum salt lake on the Qinghai-Tibet Plateau, was investigated by a polyphasic approach. The DNA G+C content of strain AJ201 T was 65.7 mol%. The major polar lipid profile and phylogenetic analysis based on 16S rRNA gene sequences supported the allocation of the strain to the genus Halorubrum. The results of DNA-DNA hybridizations and physiological and biochemical tests allowed genotypic and phenotypic differentiation of strain AJ201 T from closely related species. Therefore, strain AJ201 T represents a novel species of the genus Halorubrum, for which the name Halorubrum arcis sp. nov. is proposed. The type strain is strain AJ201 T (=CGMCC 1.5343 T =JCM 13916 T ). (McGenity & Grant, 1995;Kamekura & Dyall-Smith, 1995) are widely distributed in hypersaline habitats (Grant & Larsen, 2001). At the time of writing, there are 16 species with validly published names in the genus Halorubrum, including three alkaliphilic species, Halorubrum vacuolatum (Mwatha & Grant, 1993; Kamekura et al., 1997), Hrr. tibetense (Fan et al., 2004) and Hrr. alkaliphilum (Feng et al., 2005), and 13 neutrophilic species, Halorubrum saccharovorum (the type species; Tomlinson & Hochstein, 1976), Hrr. sodomense (Oren, 1983, Hrr. lacusprofundi (Franzmann et al., 1988), Hrr. coriense (Nuttall & Dyall-Smith, 1993), Hrr. trapanicum (McGenity & Grant, 1995; Trüper, 2003), Hrr. distributum (Zvyagintseva & Tarasov, 1987;Oren & Ventosa, 1996) (Cui et al., 2006). Here, we report the taxonomic characterization of a neutrophilic strain belonging to the genus Halorubrum. Members of the genus HalorubrumStrain AJ201 T was isolated from mud of Ayakekum salt lake (37u 379 N 89u 299 E; 3884 m altitude) located in the Altun Mountain, in the northern part of the Qinghai-Tibet Plateau. The lake environment was described previously in detail (Xu et al., 2005a). The sample was incubated with S-G medium (Sehgal & Gibbons, 1960) for approximately 1 week and the liquid was plated by using a tenfold dilution series method. After 1-2 weeks of incubation at 37 u C, a representative red colony was picked and maintained on S-G medium. The strain was purified by repeated restreaking; purity was confirmed by the uniformity of cell morphology. The optimal conditions for growth were determined in S-G medium modified with 0.85-5.1 M NaCl or 0-1.0 M Mg 2+ .Phenotypic tests and lipid analysis were performed according to Xu et al. (2005b) as mentioned previously in the minimal standards for the description of new taxa in the order Halobacteriales (Oren et al., 1997). Detailed results of cell morphology, physiological tests and antibiotic sensitivity are given in the species description. The major polar lipids of strain AJ201 T were determined to be C 20 C 20 derivatives of phosphatidylglycerol, phosphatidylglycerol phosphate methyl ester, phosphatidylglycerol sulfate and sulfated mannosyl-glucosyl-glycerol diether ( Supplementary Fig. S1 in IJSEM Online).The 16S rRNA ge...

Population and genomic analysis of the genus Halorubrum

“…However, these strains were isolated from three different geographic regions of Asia at three different time points (Zvyagintseva and Tarasov, 1987; Ventosa et al, 2004; Cui et al, 2007; Xu et al, 2007), from Chinese solar salterns to Turkmenistani saline soils. While the role of geography and ecology in haloarchaeal speciation is unsettled (Oh et al, 2010; DeMaere et al, 2013; Dillon et al, 2013; Zhaxybayeva et al, 2013) all four of the named species have undergone polyphasic characterization, including DNA-DNA hybridization (Ventosa et al, 2004; Cui et al, 2007; Xu et al, 2007). Presumably, if these taxa lived in the same environments and exchanged genes with each other in a positively biased manner like phylogroups A and B, they would be homogenized and indistinguishable by current polyphasic description processes.…”

Halorubrum luteum sp. nov., isolated from Lake Chagannor, Inner Mongolia, China

“…Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain CGSA15 T was a member of the genus Franzmann et al, 1988). At the time of writing, Halorubrum is the largest genus within the family Halobacteriaceae, with 19 recognized species, three of which are alkaliphilic and 16 neutrophilic Xu et al, 2007;Castillo et al, 2007). Of the three alkaliphilic species, Halorubrum vacuolatum was isolated from Lake Magadi, Kenya (Mwatha & Grant, 1993), Halorubrum tibetense from Lake Zabuye, Tibet, China (Fan et al, 2004), and…”

“…At the time of writing, Halorubrum is the largest genus within the family Halobacteriaceae, with 19 recognized species, three of which are alkaliphilic and 16 neutrophilic Xu et al, 2007;Castillo et al, 2007). Of the three alkaliphilic species, Halorubrum vacuolatum was isolated from Lake Magadi, Kenya (Mwatha & Grant, 1993), Halorubrum tibetense from Lake Zabuye, Tibet, China (Fan et al, 2004), and Halorubrum alkaliphilum from a soda lake of Xinjiang, China (Feng et al, 2005).…”

Halorubrum californiense sp. nov., an extreme archaeal halophile isolated from a crystallizer pond at a solar salt plant in California, USA

“…orientale (Castillo et al, 2006), Hrr. arcis (Xu et al, 2007), Hrr. litoreum (Cui et al, 2007) and Hrr.…”

“…The haloarchaeal primers used for the PCR were HK 1F (ATTCCGGTTGATCCTGCCGG) and H1492R (GTTACCTTGCCCGTTCCTTC) (Litchfield et al, 2005). The almost complete 16S rRNA gene sequence (1436 bp) of strain SF3-213 T was determined and com- Cui et al (2006Cui et al ( , 2007, Castillo et al (2006Castillo et al ( , 2007 and Xu et al (2007). +, Positive; 2, negative; +/2, doubtful; ND, no data available.…”