Hes1, a new target for interleukin 1  in chondrocytes

Abstract

Hes1 is a novel IL1beta target gene in chondrocytes which influences a discrete subset of genes linked to cartilage matrix remodelling and/or degradation.

The emerging role of Notch pathway in ageing: Focus on the related mechanisms in age-related diseases

“…Another example of Notch expression mediated by TNF-␣ is observed in a mouse pancreatic cancer model, as demonstrated Maniati and collegues in 2011 (Maniati et al, 2011). It has been reported that IL-1␤ induces Notch targets expression in chondrocytes, by inducing Notch-1 activation with a similar action of TNF-␣ (Ottaviani et al, 2010). In addition of pro-inflammatory cytokines, TGF-␤ has also been shown to directly induce Hes 1 expression.…”

CpG ODN‐induced matrix metalloproteinase‐13 expression is mediated via activation of the ERK and NF‐κB signalling pathways in odontoblast cells

“…The following synthetic gene‐specific primer sets (Sangon, Shanghai, China) were used for qPCR: MMP‐13 forward, 5‐CACAGCAAGCCAGAATAAAG‐3 and reverse, 5‐CACACATCAGTAAGCACCAAG‐3 (Ottaviani et al . ); β‐actin forward, 5′‐GGCTGTATTCCCCTCCATCG‐3′ and reverse, 5′‐CCAGTTGGTAACAATGCCATGT‐3′. Quantitative real‐time PCR was performed using an iCycler iQ5 real‐time PCR system (Bio‐Rad, Hercules, CA, USA) in the presence of the commercially available SYBR Green PCR MasterMix (Takara, Japan).…”

The Hajdu Cheney mutation sensitizes mice to the osteolytic actions of tumor necrosis factor α

“…In this study, we found greater induction of phospho-AKT by TNF␣ in Notch2 tm1.1Ecan BMM cultures. Therefore, it is possible that HES1 signals through the PI3K-AKT pathway to enhance osteoclastogenesis and induce IL1␤ (57). IL1␤ is involved in the bone-resorbing activity of osteoclasts and in osteoclast formation (37).…”