Heterologous Expression And Genetic Engineering of the Phenalinolactone Biosynthetic Gene Cluster by Using Red/ET Recombineering

Abstract

The heterologous expression of natural product biosynthetic pathways is of increasing interest in biotechnology and drug discovery. This approach enables the production of complex metabolites in more amenable host organisms and provides the basis for the generation of novel analogues through genetic engineering. Here we describe a straightforward strategy for the heterologous expression of the highly complex phenalinolactone biosynthetic pathway, which was recently cloned from Streptomyces sp. Tü6071. The biosynthetic gene cluster comprises at least 11 transcriptional units that harbor 35 genes, which together catalyze the assembly of structurally unique tricyclic terpene glycosides with antibacterial activity. By using Red/ET recombineering, the phenalinolactone pathway was reconstituted from two cosmids and heterologously expressed in several Streptomyces strains. The established expression system now provides a convenient platform for functional investigations of the biosynthetic genes and the generation of novel analogues, by genetic engineering of the pathway in Escherichia coli. Deletion of a modifying gene from the expression construct resulted in a novel, unglycosylated phenalinolactone derivative; this demonstrates the promise of this methodology.

Biochemical and Genetic Insights into Asukamycin Biosynthesis

“…Because neither 2B9 nor 10D6 carries a full set of the predicted biosynthetic genes, we modified the conventional -Red recombination strategy (20,(23)(24)(25) and reassembled the cosmids 2B9 and 10D6 into a single clone (Fig. 3).…”

“…The biosynthetic genes involved in C 5 N moiety and CHC-CoA assembly are closely positioned and appear to be co-transcribed, but many other functionally related asu genes are not organized in any apparent order. Recently, the -Red recombination system has been extended to heterologous expression (23)(24)(25). Taking advantage of the shared vector and overlapping inserts, we simplified this system and assembled two cos-mids in a single step by skipping the PCR cloning and multiple "stitching" processes (Fig.…”

Identification of Additional Players in the Alternative Biosynthesis Pathway to Isovaleryl‐CoA in the Myxobacterium Myxococcus xanthus

“…[47][48][49] The lacZ promoter region was deleted at the same time to give pTOPO_zeo_core. This plasmid was digested with BamHI/HindIII, and the T7AI promoter sequence was inserted through the annealed oligonucleotides T7A1_up (5'-AGCTTAT-A C H T U N G T R E N N U N G CAAAAAGAGTATTGACTTAAAGTCTAACCTATAGGATACTTACAGCCAT-A C H T U N G T R E N N U N G CGAGAGGTGTACATATGG-3') and T7A1_dw (5'-GATCCCATATGTACA-A C H T U N G T R E N N U N G CCTCTCGATGGCTGTAAGTATCCTATAGGTTAGACTTTAAGTCAATACTC-A C H T U N G T R E N N U N G TTTTTGATA-3') into the respective restriction sites to give the vector pCK_T7.…”

Formation and Attachment of the Deoxysugar Moiety and Assembly of the Gene Cluster for Caprazamycin Biosynthesis

“…It has been successfully applied for functional studies and engineering of antibiotic biosynthetic machineries (17), e.g., heterologous expression (10) and combinatorial biosynthesis (11). More recently, recombineering was used for the reconstitution of large biosynthetic gene clusters from overlapping inserts (3,22,57). This "stitching" overcomes the problem that genomic library clones rarely contain an entire gene cluster due to limitations of the average insert sizes.…”

“…Thiostrepton resistance mutants were selected and termed either Streptomyces sp. MK730-62F2/⌬cpzDIII/pRHAM-(1-3) or S. coelicolor/cpzLK09/pRHAM- (1)(2)(3).…”