HHEX: A Crosstalker between HCMV Infection and Proliferation of VSMCs

Abstract

Objective: The study was designed to evaluate the role of Human cytomegalovirus (HCMV) infection on homebox (HOX) gene expression and the effects of overexpression of HOX genes on proliferation and apoptosis of vascular smooth muscle cells (VSMCs).Methods: Viral infection was verified by observation of cytopathic effects through inverted microscopy, viral particles by electron microscopy and HCMV IE gene amplification by RT-PCR. cDNA profiling technology was used to screen expression of HOX genes after HCMV infection in VSMCs. Abnormal expression of Haematopoietically-expressed homeobox (HHEX) was selected to construct over-expressed vector and transfected into VSMCs. The effects of over expression of HHEX on cell proliferation and apoptosis of VSMCs were assayed by flow cytometry. Apoptosis and proliferation-associated genes were also assayed by RT-PCR.Results: Multiple HOX gene expression levels had obvious changes after HCMV infection, among which expression of HHEX gene increased obviously at 24, 48, and 72 h after infection. Over expression of HHEX can promote VSMCs proliferation by promoting G0/G1 phase cells into S phase and inhibit VSMCs apoptosis. HHEX inhibited the expression of apoptosis-associated caspase 2 and caspase3 and promoted the expression of cell cycle-related genes such as CDK2 and CDK6, CyclinB2 and CyclinD2.Conclusion: HHEX over expression induced by HCMV infection closely associated with vascular proliferative diseases.

Emodin: One Main Ingredient of Shufeng Jiedu Capsule Reverses Chemoresistance of Lung Cancer Cells Through Inhibition of EMT

“…Homebox gene, which target DNA sequence and modulate gene expression, also plays a very important regulatory role in EMT [25]. NF-κB signaling was recognized as the important inflammatory signaling pathway.…”

Gene Expression and Regulation in Mammalian Cells - Transcription From General Aspects

“…Moreover, overexpression of PRH in embryonic fibroblasts results in the expression of early, but not late, markers of VSMC differentiation [29]. It has also been reported that in VSMCs infected with Human Cytomegalovirus (HCMV) PRH up-regulation promotes cell proliferation and inhibits apoptosis [51]. Our recent work has shown that PRH inhibits the proliferation of human and rat VSMCs (see Section 6.2 [38]).…”

Bronchial Epithelial Cells Promote the Differentiation of Th2 Lymphocytes in Airway Microenvironment through Jagged/Notch-1 Signaling after RSV Infection

“…The ΔCt (average Ct – average Ct of Homo-18SrRNA) and ΔΔCt [ΔΔCt = ΔCt (experimental) – ΔCt (control)] were calculated. The relative expression was calculated from experiment to control as 2 -ΔΔCt [13]. The following primers were used in the assays: Jagged-1: 5-GCTACTACTGCGACTGTCTTCCCG-3 and 5-AGATACAGCGATAACCATTAACCAAA-3 (121 bp); Jagged-2: 5-CGCCCGTAACAACCGTCTC-3 and CAATAACTGTGCCCGCCTCAC (330 bp); DLL1: 5-GGACTCGGGCTGTTCAACTTC-3 and AGTCTTGCCATCTCACTTCCATTT (118 bp); DLL3: 5-CAGGTGCGGATGGAGGAGAD-3 and GGGCTTGAGGAGGTCACGAT (150 bp); DLL4: 5-GACAGCCCGAAAGACAGATAGG-3 and 5-GTGGGTCAGAACTGGTTATTGGA-3 (229 bp); T-bet: 5-ACTGCTCGAAACTCAGCCTCAT-3 and 5-ACCCAGTTCATTGCCGTGAC-3 (316 bp); GATA-3, 5-GCTTTGAACAAATGATTCGCCTA-3 and 5-AGGATGCCAAGAAGTTTAAGGAATAT-3 (203 bp); RORλτ: 5-TCTTCTCTCAAGTATTGGCAGGTTT-3 and 5-TCTTTCCCTACTGTTCGTTCACCA-3 (119 bp); Foxp3, 5-GTGTTGAGTGAGGGACAGGATTG-3 and 5-AAGGAAAGGAGGATGGACGAAC-3 (381 bp).…”