Higher-Level Phylogeny of New World Vireos (Aves: Vireonidae) Based on Sequences of Multiple Mitochondrial DNA Genes

Cicero, Carla; Johnson, Ned K.

doi:10.1006/mpev.2001.0944

Cited by 110 publications

(66 citation statements)

References 49 publications

(85 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

Section: Taxon and Gene Samplingmentioning

confidence: 99%

“…Frozen tissue samples (muscle tissue) were obtained from the American Museum of Natural History, Louisiana State University Museum of Natural Science, National Taiwan Normal University and the University of Kansas Natural History Museum. We also added DNA sequences from GenBank from previous studies [1,11,14,[17][18][19][20][21][22][23][24][25][26][27][28][29][30][31][32][33][34]] that overlapped our sequenced gene regions.DNA sequences were obtained for three mitochondrial genes (cytochrome b, or Cytb; nicotinamide adenine dinucleotide dehydrogenase subunit 2, or ND2; and nicotinamide adenine dinucleotide dehydrogenase subunit 3, or ND3), and three nuclear introns (the seventh intron of the beta-fibrinogen gene, or βfib7; the second intron of the myoglobin gene, or Myo2; and the fifth intron of the transforming growth factor β2, or TGFβ2). Genes were amplified using the following primers: Cytb, L14851 [35] DNA extraction, PCR amplification, sequencing, alignment and model selection DNA was extracted from frozen tissues using proteinase K digestion under manufacturer's protocols (Qiagen DNeasy tissue kit).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Reconstructing the geographic origin of the New World jays

Fernando

Peterson

2017

Neotropical Biodiversity

View full text Add to dashboard Cite

We conducted a biogeographic analysis based on a dense phylogenetic hypothesis for the early branches of corvids, to assess geographic origin of the New World jay (NWJ) clade. We produced a multilocus phylogeny from sequences of three nuclear introns and three mitochondrial genes and included at least one species from each NWJ genus and 29 species representing the rest of the five corvid subfamilies in the analysis. We used the S-DIVA, S-DEC, and BBM analyses implemented in RASP to create biogeographic reconstructions, and BEAST to estimate timing of NWJ diversification. Biogeographic reconstructions indicated that NWJs originated from an ancestor in the Eastern Palearctic or Eastern + Western Palearctic, diversified in Mesoamerica and spread subsequently to North and South America; the group has been diversifying in the New World since the late Miocene.Keywords: New World jays; Corvidae; biogeographic origin; divergence times IntroductionThe New World jays (NWJs) are a monophyletic group of corvids [1,2], presently considered to comprise seven genera (Aphelocoma, Calocitta, Cyanocitta, Cyanocorax, Cyanolyca, Gymnorhinus and Psilorhinus); the~36 species [3,4] represent the product of a radiation across much of the Americas [1]. The group has long been a focus of research in behavioral ecology, in light of complex behavioral repertoires, particularly as regards social behavior [5][6][7].The origins of corvids can be traced to Australia, from where the ancestor of the family dispersed to Asia, followed by radiations in Asia, Europe and elsewhere [8]. Ericson and colleagues [9][10][11] provided evidence that the origin of the oscine passerines, to which the Corvidae belongs, dates to the split of the AustraloPapuan tectonic plate from Antarctica in the early Tertiary,~53M years ago. Thus, the replacement of the early Tertiary rainforests in Australia by drier vegetation may have placed presumably forest-adapted early corvids in more open habitats, resulting in a new radiation that led to the present global distribution of the family. However, a recent study [12] estimated the age of the family at~20M years. Colonization of the New World by corvids occurred more recently, apparently via a transBeringian route [8]. The ancestor of NWJs, thought to be jay-like lineages related to Cissa and Urocissa, reached North America 10−8M years ago, in the Miocene [13]. Once in the Americas, a rapid radiation in South America by the early Pliocene, was apparently followed by a secondary radiation in These previous studies, however, did not provide sufficient detail in terms of representation of taxa of NWJs and other corvids to permit thorough understanding the geographic origin of NWJs or to identify their closest corvid relatives. The key deficiency has been in terms of representation of taxa from the deepest branches of the corvid phylogeny; thus, we here derive a denser phylogenetic hypothesis by deriving DNA sequences for Neotropical Biodiversity, 2017 Vol. 3, No. 1, 80-92, https://doi.org/10.1080/23766808.2017 Published on...

show abstract

Section: Taxon and Gene Samplingmentioning

confidence: 99%

mentioning

confidence: 99%

Reconstructing the geographic origin of the New World jays

Fernando

Peterson

2017

Neotropical Biodiversity

View full text Add to dashboard Cite

show abstract

“…For outgroup comparisons, we included representatives of all other NWJ genera (Cyanocitta cristata, Aphelocoma coerulescens, Gymnorhinus cyanocephalus, and Cyanolyca viridicyanus), which data were drawn from previous studies (Espinosa de los Monteros and Cracraft, 1997;Cicero and Johnson, 2001;Ericson et al, 2005;Bonaccorso and Peterson, 2007;Bonaccorso, 2009). Tissue samples for ingroup taxa were obtained through our sampling efforts (in Mexico, El Salvador, Guyana, Paraguay, and Argentina) via University of Kansas Natural History Museum general collecting expeditions, and from other museum collections in the U.S. (Table 1).…”

Section: Taxon and Gene Samplingmentioning

confidence: 99%

Molecular systematics and evolution of the Cyanocorax jays

Bonaccorso

Peterson

Navarro‐Sigüenza

et al. 2010

Molecular Phylogenetics and Evolution

View full text Add to dashboard Cite

Abstract. Phylogenetic relationships were studied in the genus Cyanocorax (Aves: Corvidae) and related genera, Psilorhinus and Calocitta, a diverse group of New World jays distributed from the southern United States south to Argentina. Although the ecology and behavior of some species in the group have been studied extensively, lack of a molecular phylogeny has precluded rigorous interpretations in an evolutionary framework. Given the diverse combinations of plumage coloration, size, and morphology, the taxonomy of the group has been inconsistent and understanding of biogeographic patterns problematic. Moreover, plumage similarity between two geographically disjuct species, the Tufted Jay (Cyanocorax dickeyi) from western Mexico and the White-tailed Jay (C. mystacalis) from western Ecuador and Peru, has puzzled ornithologists for decades. Here, a phylogeny of all species in the three genera is presented, based on study of two mitochondrial and three nuclear genes. Phylogenetic trees revealed the non-monophyly of Cyanocorax, and the division of the whole assemblage in two groups: "Clade A" containing Resumen. Se estudiaron las relaciones filogenéticas en los géneros Cyanocorax, Psilorhinus y Calocitta (Aves: Corvidae), un grupo diverso de urracas del Nuevo Mundo cuyas especies se distribuyen desde el sur de los Estados Unidos hasta Argentina. Aunque la ecología y el comportamiento de algunas especies en el grupo han sido estudiadas extensamente, la falta de una filogenia molecular ha impedido la interpretación rigurosa de estos estudios en un marco evolutivo. Dadas las diversas combinaciones de coloración de plumaje, tamaño y morfología presentes en las especies del grupo, su taxonomía ha sido inconsistente y la interpretación de sus patrones biogeográficos ha sido problemática. Mas aún, la similitud de plumaje en especies que están geográficamente distantes, como Cyanocorax dickeyi del oeste de Mexico y C. mystacalis del oeste de Ecuador y Perú, ha sido difícil de interpretar. Se presenta una filogenia para todas las especies en los tres géneros, basada en el estudio de dos genes nucleares y dos genes mitocondriales. Los árboles filogenéticos mostraron la parafilia de Cyanocorax y la división de todas las especies en dos grupos: "Clado A" en el cual se encuentran Psilorhinus morio, ambas especies Calocitta, Cyanocorax violaceus, C. caeruleus, C. cristatellus, y C. cyanomelas, y "Clado B" en el cual se encuentran el resto de las especies de Cyanocorax. Las relaciones entre especies del Clado A fueron ambiguas y, en general, poco resueltas. En el Clado B, los análisis mostraron la monofilia de las especies en "Cissilopha", pero no indicaron la monofilia de C. mystacalis + C. dickeyi. La complejidad filogenética de los linajes en el grupo sugiere varias complicaciones en el entendimiento de su biogeografía y taxonomía. Con base en los resultados filogenéticos se reconoce un solo género, Cyanocorax, con Psilorhinus y Calocitta como sinónimos.

show abstract

“…The DNA pellets were rehydrated in 20 μL of nuclease-free water. The PCR amplification was accomplished using the Cytb avian-a (forward, GACTGTGA CAAAATCCCNTTCCA; reverse, GGTCTTCATCTYHGG YTTACAAGAC) 24 and mammalian-a (forward, CGAAGC TTGATATGAAAAACCATCGTTG; reverse, TGTAGTTR TCWGGGTCHCCTA) 25 primers as previously desribed. 26 Amplicons were visualized using 2% Agarose E-Gel gels (Invitrogen Inc.).…”

Section: Methodsmentioning

confidence: 99%

Evaluation of a Field-Portable DNA Microarray Platform and Nucleic Acid Amplification Strategies for the Detection of Arboviruses, Arthropods, and Bloodmeals

Grubaugh¹,

Petz²,

Melanson³

et al. 2013

The American Society of Tropical Medicine and Hygiene

View full text Add to dashboard Cite

Abstract. Highly multiplexed assays, such as microarrays, can benefit arbovirus surveillance by allowing researchers to screen for hundreds of targets at once. We evaluated amplification strategies and the practicality of a portable DNA microarray platform to analyze virus-infected mosquitoes. The prototype microarray design used here targeted the nonstructural protein 5, ribosomal RNA, and cytochrome b genes for the detection of flaviviruses, mosquitoes, and bloodmeals, respectively. We identified 13 of 14 flaviviruses from virus inoculated mosquitoes and cultured cells. Additionally, we differentiated between four mosquito genera and eight whole blood samples. The microarray platform was field evaluated in Thailand and successfully identified flaviviruses (Culex flavivirus, dengue-3, and Japanese encephalitis viruses), differentiated between mosquito genera (Aedes, Armigeres, Culex, and Mansonia), and detected mammalian bloodmeals (human and dog). We showed that the microarray platform and amplification strategies described here can be used to discern specific information on a wide variety of viruses and their vectors.

show abstract

Higher-Level Phylogeny of New World Vireos (Aves: Vireonidae) Based on Sequences of Multiple Mitochondrial DNA Genes

Cited by 110 publications

References 49 publications

Reconstructing the geographic origin of the New World jays

Reconstructing the geographic origin of the New World jays

Molecular systematics and evolution of the Cyanocorax jays

Evaluation of a Field-Portable DNA Microarray Platform and Nucleic Acid Amplification Strategies for the Detection of Arboviruses, Arthropods, and Bloodmeals

Contact Info

Product

Resources

About