Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase

Abstract

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.

Germline Whole-Gene Deletion of FH Diagnosed from Tumor Profiling

“…Several previously reported Japanese families with HLRCC exhibited different pathogenic variants, including missense variants and a splice site variant that had not been reported in Caucasian families [ 18 , 19 , 20 , 21 , 22 , 23 ]. To the best of our knowledge, ours is the first report of a whole-gene FH deletion in Japan.…”

Metabolic Deregulations Affecting Chromatin Architecture: One-Carbon Metabolism and Krebs Cycle Impact Histone Methylation

“…In addition to IDH1 and IDH2, mutations of the fh, sdha, sdhb, sdhc, sdhd, and sdhaf2 genes, which encode subunits of fumarase (FH) and succinate dehydrogenase (SDH) complexes, are also found in some cancers such as paragangliomas, renal cell carcinomas, pheochromocytoma, and gastrointestinal stromal tumors (Toro et al 2003;Bayley et al 2008;Hao et al 2009;Kaelin 2009;Bardella et al 2011;Gill 2018;Matsumoto et al 2018). Such mutations correspond to a loss of function, and therefore cause accumulation of fumarate and succinate (Pollard et al 2005), which disrupts the histone and DNA methylation patterns through inhibition of α-ketoglutarate dependent dioxygenases, in a similar way to 2-hydroxyglutarate (Xiao et al 2012) (Fig.…”