Human papillomavirus type 8 contains cis-active positive and negative transcriptional control sequences

Human papillomavirus type 6 (HPV-6) DNA is the predominant HPV type found in condyloma acuminata: it is rarely found in carcinomas. We have previously reported cloning and characterizing an HPV-6 from a vulvar condyloma (HPV6-W50) and an HPV-6 from a vulvar carcinoma (HPV6-T70). The E5, E6 and E7 proteins encoded by the two genomes were identical, however, the two genomes differed in the long control region (LCR). Cloning of the entire LCR into the enhancerless plasmid pSVEcat showed that the two LCRs had comparable enhancer activity. Since the major differences between the two LCRs resided in the 5' end of the LCR, upstream of the L1 polyadenylation signal, we subcloned the two LCRs to analyse more closely their effect on cat gene expression. The data indicated that LCR subclones of the two genomes had comparable chloramphenicol acetyltransferase (CAT) activity. A negative regulatory region was detectable when the test plasmids were transfected into HeLa and C33A cells and in primary keratinocytes. A decrease in CAT activity was also detected when the SV40 early promoter was replaced with the putative HPV-6 E6 promoter. The negative regulatory region functioned in a position-and orientation-independent manner, thus fulfilling the definition of a silencer.

Section: Introductionmentioning

confidence: 99%

Detection of silencer activity in the long control regions of human papillomavirus type 6 isolated from both benign and malignant lesions

Farr

Pattison

Youn

et al. 1995

“…Briefly, two separate PCR reactions were performed, each using either a 5h or a 3h flanking primer (P3, 5h AGGTCGACGGATCCCCGGGAATTCATC 3h ; P4, 5h GCGAGCTCGAGATCTAGATATCTCCA 3h) and one of the central complementary primers carrying the desired mutations. Primers P3 and P4 were located over the boundaries of the HPV-8 insert (nt 7078-555) of plasmid pPF43 (Reh & Pfister, 1990) used as a PCR template. Both amplified DNA fragments were gel-purified, mixed and subjected to the second PCR with primers P3 and P4.…”

Section: Methodsmentioning

confidence: 99%

Regulatory interactions of transcription factor YY1 with control sequences of the E6 promoter of human papillomavirus type 8.

Pajunk

May

Pfister

et al. 1997

Human papillomavirus type 8 (HPV-8) is a strictly cutaneous oncogenic virus known to induce malignant skin lesions in epidermodysplasia verruciformis patients. Our study shows that sequences surrounding transcription start sites of the HPV-8 oncogene E6 (nt 175-179) and comprising the presumable CCAAC and TATA boxes of the E6 promoter P 175 contain a cluster of four motifs similar to the DNA recognition site of the multifunctional cellular transcription factor yin-yang 1 (YY1). Using DNase I footprinting and gel retardation tests it could be demonstrated that three of these motifs indeed act as YY1 binding sites. To test their functional relevance for P 175 activity, engineered YY1 binding site mutants were analysed in the

“…DNase I footprinting of HPV-16 has shown the presence of 23 footprints within the 900 bp LCR (Gloss et al, 1989), suggesting an intricate array of regulatory elements although some of these sites may be involved in replication rather than transcriptional control (Lusky & Botchan, 1984). In addition to E2-independent enhancer elements identified in several papillomaviruses (Hirochika et al, 1987;Gloss et al, 1989;Cripe et al, 1987;Wu & Mounts, 1988; Chin et at., I989), silencer elements have also been demonstrated in HPV-6 and HPV-8 (Wu & Mounts, 1988;Reh & Pfister, 1990). Thus the regulation of papillomavirus transcription by the LCR is complex, involving both host-and virus-encoded proteins.…”

Section: Introductionmentioning

confidence: 99%

Positive and negative E2-independent regulatory elements in the long control region of bovine papillomavirus type 4

1991

The long control region (LCR) of bovine papillomavirus type 4 demonstrated enhancer activity when cloned upstream of a bacterial chloramphenicol acetyltransferase reporter gene under thymidine kinase promoter control. Deletion analysis of the LCR revealed the presence of several positive and negative control elements, all of which could function independently of the viral E2 trans-activator. Each of the three positive elements present appeared to be paired with a negative element which modulated its activity. DNase I footprinting was used to identify protein binding sites within the LCR, which might represent these control elements. The results suggest a highly complex and finely tuned control of viral gene expression.