Identification and characterisation of a group of cervical carcinoma patients with profound downregulation of intratumoral Type 1 (IFNγ) and Type 2 (IL-4) cytokine mRNA expression

Gey, Alain; Kumari, Priyanka; Sambandam, Arivazhagan; Lécuru, Fabrice; Cassard, Lydie; Badoual, Cécile; Fridman, C.; Nagarajan, B.; Fridman, Wolf Herman; Tartour, Éric

doi:10.1016/s0959-8049(02)00839-0

Cited by 21 publications

(13 citation statements)

References 55 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…PCR was performed as previously described. 27 The following oligonucleotides were used: ␤ actin sense, TCGTCGACAACGGCTCCGGCATGTGC; ␤ actin antisense, TTCTCCAGGGAGGAGCTGGAAGCAGC; IL-6 sense, ACGAATTGACAAACAAATTCGGTACA; IL-6 antisense, CATCTAGATTCTTTGCCTTTTTCTGC; IL-8 sense, TTCTG-CAGCTCTGTGTGAAGGT; IL-8 antisense, GAAGAGGGCT-GAGAATTCAT; IL-17 sense, ACTCCTGGGAAGACCT-CATTG; IL-17 antisense, GGCCACATGGTGGACAATCG; IL-17R sense, CTAAACTGCACGGTCAAGAATAG; IL-17R antisense, ATGAACCAGTACACCCAC. Each RT-PCR includes a negative control without a cDNA template.…”

Section: Rt-pcr Amplificationsmentioning

confidence: 99%

Expression and activity of IL‐17 in cutaneous T‐cell lymphomas (mycosis fungoides and sezary syndrome)

Cirée

Michel

Camilleri-Broët

et al. 2004

Intl Journal of Cancer

103

View full text Add to dashboard Cite

Interleukin-17 (IL-17) is a proinflammatory cytokine mainly produced by activated CD4 ؉ CD45RO T cells. In mice, we have demonstrated that, depending on the model, IL-17 may act as a tumor growth-promoting or -inhibiting factor. In order to address the relevance of these models in human tumors, we look for the natural expression and activity of IL-17 in mycosis fungoides (MF) and Sezary syndrome (SS). These cutaneous T-cell lymphomas were selected because they are usually CD3 ؉ CD4 ؉ CD45RO ؉ , a phenotype similar to nontransformed T cells producing IL-17. We show that in vitro activated malignant T cells derived from MF or SS patients express IL-17 mRNA and secrete this cytokine. However, IL-17 does not act in vitro as a growth factor for MF or SS cell lines. In addition, 5 out of 10 MF/SS biopsies expressed IL-17 mRNA, while this cytokine was not detected in normal skin. IL-17 was not observed in the biopsies derived from 2 patients initially identified as MF, whereas an upregulation of this cytokine was clearly demonstrated during progression of the disease in these patients. An association between IL-17 expression and polymorphonuclear neutrophil infiltration was also recorded in this group of MF/SS patients. A more detailed analysis of 2 patients with a pustular form of MF and SS revealed that IL-17 may participate in the recruitment of polymorphonuclear neutrophils via a paracrine mechanism involving keratinocyte-released IL-8. This study is the first report demonstrating that some human tumor cells could express IL-17, a cytokine that represents an early event in the development of the inflammatory reaction within the tumor microenvironment, a process that may influence tumor phenotype and growth.

show abstract

Section: Rt-pcr Amplificationsmentioning

confidence: 99%

Expression and activity of IL‐17 in cutaneous T‐cell lymphomas (mycosis fungoides and sezary syndrome)

Cirée

Michel

Camilleri-Broët

et al. 2004

Intl Journal of Cancer

103

View full text Add to dashboard Cite

show abstract

“…17,18 Accordingly, it has been shown that type I IFNs are downregulated in keratinocytes infected with HPV16 19 and in HPV þ cervical carcinoma cell lines, 20 and IFN-g expression is significantly decreased in cervical carcinoma tissue. 21,22 Convincing evidence exists illustrating the inhibitory effects of HPV on IFNs. However, no investigations into the effect of a DNA virus, such as HPV, on IFN-k expression exist for the full spectrum of cervical disease.…”

mentioning

confidence: 99%

IFN-κ, a novel type I IFN, is undetectable in HPV-positive human cervical keratinocytes

DeCarlo

Severini

Edler

et al. 2010

Laboratory Investigation

View full text Add to dashboard Cite

Interferons (IFNs) are expressed by many cell types and play a pivotal role in the generation of immune responses against viral infections. IFN-k, a novel type I IFN, displays a tight tropism for keratinocytes and specific lymphoid populations and exhibits functional similarities with other type I IFNs. The human papillomavirus (HPV), the etiological agent for cervical cancer, infects keratinocytes of the uterine cervix and has been shown to directly inhibit the IFN pathway. We evaluated IFN-k, -b, and -g gene expression in HPV-negative normal and HPV-positive pre-malignant and malignant ex vivo cervical tissue covering the entire spectrum of cervical disease. Quantitative real-time polymerase chain reaction and methods previously optimized for detecting low-expressing genes in cervical tissue were used. In contrast to IFN-b and -g, IFN-k mRNA prevalence and levels were unexpectedly higher in diseased compared with normal whole cervical tissue with highest levels observed in invasive carcinoma tissue. Strikingly, laser capture microdissection revealed an absence of IFN-k mRNA in diseased epithelium, whereas stromal IFN-k was found exclusively in diseased tissue. IFN-g and IFN-b were likewise found to be upregulated in diseased cervical stroma. Immunofluorescence supports the involvement of monocytes and dendritic cells in the stromal induction of IFNs in diseased tissue. Further, using three-dimensional raft cultures in which the viral life cycle can be mimicked, human keratinocytes transfected with full-length HPV16 displayed a significant decrease in IFN-k mRNA compared with non-transfected human keratinocytes. Altogether, these findings show that IFN-k is down-regulated in cervical keratinocytes harboring HPV, which may be a contributing factor in the progression of a cervical lesion. Interferons (IFNs) have a critical role in the generation of an innate immune response against invading pathogens and, as a consequence, are an approved therapy for many diseases 1,2 including human papillomavirus (HPV)-associated diseases. 3,4 On infection, IFNs are synthesized and secreted to evoke anti-viral, 5 anti-tumor, 6 and immunoregulatory (reviewed in Stetson and Medzhitov 7 ) activity conferring protection to neighboring cells. Two main classes of IFNs exist. The type I IFNs, consisting of IFN-a, -b, -k, -d, -e, -o, and -t, share a common receptor and downstream signaling pathways (reviewed in Pestka et al. 8 ) and are chiefly involved in generating anti-viral activity in response to pathogens. The sole member of the type II IFN subclass, IFN-g, uses a discrete type II IFN receptor, 9 distinct signaling pathways and is primarily involved in the regulation of immune and inflammatory responses. IFN-k, a newly identified type I IFN, has been shown to signal through the type I IFN pathway 10 and displays a tight tropism for keratinocytes, monocytes (MCs), and dendritic cells (DCs). 10 IFN-k has been shown to display similar anti-viral activity to other type I IFNs. 11 However, it is distinct from other type I IFNs, as it...

show abstract

“…The DA-3 mammary tumor cell line was derived in our laboratory from the D1-DMBA-3 tumor and maintained in DMEM/high glucose, 10% characterized heat-inactivated FCS (HyClone Laboratories, Logan, UT), 100 U/ml penicillin, and 100 µg/ml streptomycin with OPI medium supplement (SigmaAldrich, St. Louis, MO). Tumor cells (1x10 6 DA-3, and 1x10 6 IFN-γ-transfected DA-3 cells) were injected s.c., and 4-5-weekold tumor-implanted animals were used for the indicated studies.…”

Section: Methodsmentioning

confidence: 99%

“…Tumor cells were implanted by s.c. injection of 1x10 6 tumor cells in 0.9% saline. Tumor volumes were calculated by measuring two diameters of the tumor (x, small diameter; y, large diameter) using digital calipers and entering measurements into the equation tumor volume = x 2 y(0.52).…”

Section: Measurement Of Tumor Volume and Survival Curvementioning

confidence: 99%

See 1 more Smart Citation

Decreased accumulation of immune regulatory cells is correlated to the antitumor effect of IFN-γ overexpression in the tumor

et al. 2011

View full text Add to dashboard Cite

Abstract. During mammary tumorigenesis, there is a profound tumor-induced immunosuppression and a progressive thymic atrophy associated with tumor development. IFN-γ has been shown to be effective in enhancing antitumor responses in several tumor models, however, how IFN-γ exerts its anti-tumor effect is largely controversial. In the present study we have used a mammary tumor model to investigate whether the levels of IFN-γ have an important role in the tumor-induced immunosuppression as well as in the pathogenesis of the thymic atrophy. We evaluated this possibility using DA-3 cells transfected to express IFN-γ (DA-3/IFN-γ), a system that provides constant, local production of IFN-γ within the tumor microenvironment. Overexpression of IFN-γ in the mammary tumor results in a marked delay of tumor growth, a reduction in regulatory T cells and myeloid-derived suppressor cells accumulation mostly due to down-regulation of chemokines implicated in the recruitment of immune regulatory cells, and a blockage in the tumorassociated thymus atrophy. Collectively, our data suggest that the replacement of the faulty levels of IFN-γ in the tumor results in a diminution of the tumor-induced immune suppression caused by the mammary tumor development.

show abstract

Identification and characterisation of a group of cervical carcinoma patients with profound downregulation of intratumoral Type 1 (IFNγ) and Type 2 (IL-4) cytokine mRNA expression

Cited by 21 publications

References 55 publications

Expression and activity of IL‐17 in cutaneous T‐cell lymphomas (mycosis fungoides and sezary syndrome)

Expression and activity of IL‐17 in cutaneous T‐cell lymphomas (mycosis fungoides and sezary syndrome)

IFN-κ, a novel type I IFN, is undetectable in HPV-positive human cervical keratinocytes

Decreased accumulation of immune regulatory cells is correlated to the antitumor effect of IFN-γ overexpression in the tumor

Contact Info

Product

Resources

About