Identification and validation of reference genes for quantitative real-time PCR studies in long yellow daylily, Hemerocallis citrina Borani

Abstract

Gene expression analysis using reverse transcription quantitative real-time PCR (RT-qPCR) requires the use of reference gene(s) in the target species. The long yellow daylily, Hemerocallis citrina Baroni. is rich in beneficial secondary metabolites and is considered as a functional vegetable. It is widely cultivated and consumed in East Asian countries. However, reference genes for use in RT-qPCR in H. citrina are not available. In the present study, six potential reference genes, actin (ACT), AP-4 complex subunit (AP4), tubulin (TUB), ubiquitin (UBQ), 18S and 60S ribosomal RNA, were selected and their expression stability in different developmental stages, organs and accessions was evaluated using four statistical software packages (geNorm, NormFinder, BestKeeper, and RefFinder). For commercial flower buds of different landraces, the combination of 60S, TUB, and AP4 was appropriate whereas ACT and 60S was suitable for normalization of different organs. In addition, AP4 exhibited the most stable expression in flower buds among different developmental stages. UBQ was less stable than the other reference genes under the experimental conditions except under different organs was 18S. The relative expression levels of two genes, primary-amine oxidase (HcAOC3) and tyrosine aminotransferase (HcTAT) which play important roles in alkaloid biosynthesis were also examined in different organs of the ‘Datong’ landrace, which further confirmed the results of selected reference genes. This is the first report to evaluate the stability of reference genes in the long yellow daylily that can serve as a foundation for RT-qPCR analysis of gene expression in this species.

Characterization of Hemerocallis citrina Transcriptome and Development of EST-SSR Markers for Evaluation of Genetic Diversity and Population Structure of Hemerocallis Collection

“…The primers sequences for this gene were GAGCAAGGAAATCACGGCACT (forward primer) and GGAACCTCCAATCCAAACACTGTAC (reverse primer). RT-PCR procedure followed Hou et al (2017). Each sample had three biological and three technical replications.…”

Selection and Validation of Reference Genes for Quantitative Real-Time PCR Analysis of Development and Tissue-Dependent Flower Color Formation in Cymbidium lowianum

“…Thus, the selection of appropriate reference genes and design of specific primers are prerequisites for ensuring the accuracy of qRT-PCR results [ 10 ]. Housekeeping genes are often used as standardized reference genes, but the expression of many housekeeping genes varies greatly in different tissues, different species, and under different environmental conditions [ 7 , 11 , 12 , 13 , 14 , 15 , 16 ].…”

Transcriptome sequencing and expression profiling of genes involved in daylily (Hemerocallis citrina Borani) flower development

“…Daylily has distichously arranged long, linear leaves, and showy flowers, which are borne on short pedicels [1]. The flower buds are commonly used as a vegetable in Asia [2]. Recent studies showed that the flowers of daylily have more antioxidant compounds than other plants, making it an excellent nutraceutical food and sparking a potential for medical use [3,4].…”