Improved typing procedure for the polymorphic single‐copy RLA‐DQA gene of the rabbit reveals a new allele

Fain, Michelle A; Zhao, Tiantian; Kindt, Thomas J.

doi:10.1034/j.1399-0039.2001.057004332.x

Cited by 13 publications

(7 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The PCR products from first round were diluted 100-fold and used as the template. The amplicons were separated by SSCP analyses as described by Fain [35]. Five µL of each PCR product were mixed with an equal volume of 95% formamide, denatured for 5 min at 99°C and immediately chilled on ice water for 10 min.…”

Section: Methodsmentioning

confidence: 99%

Characterization, Polymorphism and Selection of Major Histocompatibility Complex (MHC) DAB Genes in Vulnerable Chinese Egret (Egretta eulophotes)

et al. 2013

View full text Add to dashboard Cite

The major histocompatibility complex (MHC) is an excellent molecular marker for the studies of evolutionary ecology and conservation genetics because it is a family of highly polymorphic genes that play a key role in vertebrate immune response. In this study, the functional genes of MHC Class II B (DAB) were isolated for the first time in a vulnerable species, the Chinese egret ( Egretta eulophotes ). Using a full length DNA and cDNA produced by PCR and RACE methods, four potential MHC DAB loci were characterized in the genome of this egret and all four were expressed in liver and blood. At least four copies of the MHC gene complex were similar to two copies of the minimal essential MHC complex of chicken, but are less complex than the multiple copies expressed in passerine species. In MHC polymorphism, 19 alleles of exon 2 were isolated from 48 individuals using PCR. No stop codons or frameshift mutations were found in any of the coding regions. The signatures of positive selection detected in potential peptide-binding regions by Bayesian analysis, suggesting that all of these genes were functional. These data will provide the fundamental basis for further studies to elucidate the mechanisms and significance of MHC molecular adaptation in vulnerable Chinese egret and other ardeids.

show abstract

Section: Methodsmentioning

confidence: 99%

Characterization, Polymorphism and Selection of Major Histocompatibility Complex (MHC) DAB Genes in Vulnerable Chinese Egret (Egretta eulophotes)

et al. 2013

View full text Add to dashboard Cite

show abstract

“…Exon 2 of DQA locus was amplified using the primers DQAF: 5′‐TCATCAGCTGACCACGTTGG‐3′ and DQAR: 5′‐GACAGCAGCAGTAGAGTTGG‐3′, which were based on the rabbit DQA sequence (Fain et al. 2001) with slight modifications.…”

Section: Methodsmentioning

confidence: 99%

Major histocompatibility complex variation at class II DQA locus in the brown hare (Lepus europaeus)

et al. 2009

View full text Add to dashboard Cite

The major histocompatability complex (MHC) is a multigene family of receptors that bind and present antigenic peptides to T-cells. Genes of the MHC are characterized by an outstanding genetic polymorphism, which is considered to be maintained by positive selection. Sites involved in peptide binding form binding pockets (P) that are collectively termed the peptide-binding region (PBR). In this study, we examined the level of MHC genetic diversity within and among natural populations of brown hare (Lepus europaeus) from Europe and Anatolia choosing for analysis of the second exon of the DQA locus, one of the most polymorphic class II loci. We aimed at an integrated population genetic analysis of L. europeaus by (i) correlating MHC polymorphism to genetic variability and phylogenetic status estimated previously from maternally (mtDNA) and biparentally (allozymes, microsatellites) inherited loci; and (ii) comparing full-length exon amino acid polymorphism with functional polymorphism in the PBR and the binding pockets P1, P6 and P9. A substantial level of DQA exon 2 polymorphism was detected with two completely different set of alleles between the Anatolian and European populations. However, the phylogeny of full-length exon 2 Leeu-DQA alleles did not show a strong phylogeographic signal. The presence of balancing selection was supported by a statistically significant excess of nonsynonymous substitutions over synonymous in the PBR and a trans-species pattern of evolution detected after phylogenetic reconstruction. The differentiating patterns detected between genetic and functional polymorphism, i.e. the number and the distribution of pocket variants within and among populations, indicated a hierarchical action of selection pressures.

show abstract

“…1989). More recent studies use rabbit MHC genes for population genetic analysis but focus on the gene DQA (Fain et al. 2001; Goüy de Bellocq et al.…”

Section: Introductionmentioning

confidence: 99%

Major histocompatibility complex variation and age-specific endoparasite load in subadult European rabbits

et al. 2010

View full text Add to dashboard Cite

Genes of the major histocompatibility complex (MHC) play a fundamental role in the vertebrate immune response and are amongst the most polymorphic genes in vertebrate genomes. It is generally agreed that the highly polymorphic nature of the MHC is maintained through host-parasite co-evolution. Two nonexclusive mechanisms of selection are supposed to act on MHC genes: superiority of MHC heterozygous individuals (overdominance) and an advantage for rare MHC alleles. However, the precise mechanisms and their relative importance are still unknown. Here, we examined MHC dependent parasite load in European rabbits (Oryctolagus cuniculus) from a distinct population with low MHC diversity (three alleles, six genotypes). Using a multivariate approach, we tested for associations of individual MHC class II DRB constitution and the rabbits' intestinal burden with nematodes and coccidia. Rabbits having a particular allele showed lower infestations with hepatic coccidia (E. stiedai). However, a comparison of all six genotypes in the population revealed that carriers of this allele only benefit when they are heterozygous, and furthermore, MHC heterozygosity in general did not affect individual parasite load. In conclusion, this study suggests an immunogenetic basis of European rabbit resistance to hepatic coccidiosis, which can strongly limit survival to maturity in this species. Our study gives a complex picture of MHC-parasite correlations, unveiling the limits of the classical hypotheses of how MHC polymorphism is maintained in natural systems.

show abstract

Improved typing procedure for the polymorphic single‐copy RLA‐DQA gene of the rabbit reveals a new allele

Cited by 13 publications

References 22 publications

Characterization, Polymorphism and Selection of Major Histocompatibility Complex (MHC) DAB Genes in Vulnerable Chinese Egret (Egretta eulophotes)

Characterization, Polymorphism and Selection of Major Histocompatibility Complex (MHC) DAB Genes in Vulnerable Chinese Egret (Egretta eulophotes)

Major histocompatibility complex variation at class II DQA locus in the brown hare (Lepus europaeus)

Major histocompatibility complex variation and age-specific endoparasite load in subadult European rabbits

Contact Info

Product

Resources

About