Improving knowledge of the subgenus Agrodiaetus (Lepidoptera: Lycaenidae: Polyommatus) in Eastern Europe: Overview of the Romanian fauna

Dincă, Vlad; Székely, Levente; Bálint, Zsolt; Skolka, Marius; Torok, Sergiu

doi:10.14411/eje.2017.023

Cited by 6 publications

(2 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…To put them in context, we mined 19 additional COI sequences from GenBank, a subset where the most similar sequences to the Albanian ones were included and overlapped at least 650 base pairs (bp) of the cytochrome c oxidase subunit (COI). DNA extraction was done following the protocol described in Dincă et al (2017). The primers LepF1 and LepR1 (ATTCAACCAATCATAAAGATATTGG and TAAACTTCTGGATGTC-CAAAAAATCA respectively) were employed for the COI amplification, obtaining a full DNA barcode fragment of 658 base pairs (bp).…”

Section: Dna Extraction and Sequencingmentioning

confidence: 99%

“…With over 120 species described, this subgenus is a striking example of explosive radiation in the last three million years (Kandul et al 2004;Kandul et al 2007;Talavera et al 2013b). Sexes are often dimorphic, with females usually brown in colour, and with males displaying colours such as blue, white, silver, orange, violet, or brown on the dorsal part of the wings, which is probably a signature of the reinforcement of pre-zygotic isolation (Lukhtanov et al 2005;Dincă et al 2017).…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Integrative analysis reveals cryptic speciation linked to habitat differentiation within Albanian populations of the anomalous blues (Lepidoptera, Lycaenidae, Polyommatus Latreille, 1804)

Parmentier¹,

Vila²,

Lukhtanov³

2022

CCG

View full text Add to dashboard Cite

The Balkan Peninsula is one of the greatest hotspots for biodiversity in Europe. While the region has been investigated thoroughly, some parts remain understudied and may still harbour undiscovered diversity, even in well-studied organisms such as Lepidoptera. Here we investigated the group of the so-called anomalous blue butterflies, also known as ‘brown complex’ of the subgenus Agrodiaetus Hübner, 1822 including the taxa of the entire Polyommatus aroaniensis (Brown, 1976) species complex. This species complex is distributed in the southern part of the Balkan Peninsula and known to be represented by three closely related allopatric species, differentiated by their chromosome numbers (n) and mitochondrial (mt) DNA. These are P. aroaniensis sensu stricto (Southern Greece, Peloponnese, n=47–48; mt haplogroup aroa1), P. timfristos Lukhtanov, Vishnevskaya et Shapoval, 2016 (Central Greece, Attika, n=38, aroa2) and P. orphicus Kolev, 2005 (North-Eastern Greece, Southern Bulgaria, n=41–42, orph1). Based on an analysis of chromosomal, molecular and morphological markers, we demonstrate that a fourth taxon of this species complex exists in Albania. This taxon possesses the mt haplogroup aroa3, which is the most differentiated within the entire P. aroaniensis species complex, and the karyotype (n=42–43), which differs by one fixed chromosome fission from P. orphicus. The Albanian taxon seems to be ecologically specialised (habitat on dark-coloured, ophiolitic substrate soils) and differs in colouration (wing reflectance) from the others taxa of the P. aroaniensis species group. Based on the evidence here presented and following the current view of the taxonomy of the group, we propose considering the Albanian taxon as a new species, here described as Polyommatus luraesp. nov. At the contact zone between the new species and P. orphicus, in addition to typical ones, we detected specimens with haplogroup orph2, karyotype n=43 and intermediate morphology, which seem to represent P. lurae × P. orphicus hybrids.

show abstract

Section: Dna Extraction and Sequencingmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Integrative analysis reveals cryptic speciation linked to habitat differentiation within Albanian populations of the anomalous blues (Lepidoptera, Lycaenidae, Polyommatus Latreille, 1804)

Parmentier¹,

Vila²,

Lukhtanov³

2022

CCG

View full text Add to dashboard Cite

show abstract

Genetics and extreme confinement of three overlooked butterfly species in Romania call for immediate conservation actions

Groza¹,

Vodă²,

Székely

et al. 2020

J Insect Conserv

View full text Add to dashboard Cite

Extremely Endangered Butterflies of Scattered Central European Dry Grasslands Under Current Habitat Alteration

Bartoňová

Konvička

Marešová

et al. 2021

Insect Systematics and Diversity

View full text Add to dashboard Cite

Central European dry grasslands represent extrazonal patches of the Eurasian steppe biome. They suffer from severe habitat alterations due to land-use changes, abandonment, or inappropriate management. The butterflies Chazara briseis (Linnaeus, 1764) (Lepidoptera: Nymphalidae), Polyommatus damon (Denis & Schiffermüller, 1775) (Lepidoptera: Lycaenidae), and Polyommatus dorylas (Denis & Schiffermüller, 1775) (Lepidoptera: Lycaenidae), specialized inhabitants of these steppe patches, are all swiftly disappearing from Central Europe. We reviewed data on the recent history of their population retractions in the region, including conservation efforts. Using samples from their whole distribution ranges, we sequenced and analyzed COI and wingless genes and together with Species Distribution Modelling reconstructed their biogeographic histories. Populations of C. briseis expanded over the Eurasian steppe biome, where large ungulates maintained extensive grasslands with short open sward. Polyommatus damon became widespread in the steppes during glacial times, and retracted during interglacials, resembling cold-adapted species. It is limited by too dry weather, and it requires disturbed grassland followed by temporal abandonment. Its present genetic structure was induced by the major Pleistocene Mountain glaciations. Polyommatus dorylas prefers an oceanic climate and populated Central Europe from the Balkans during the Holocene. The species depends on disturbed ground. Currently, all three species inhabit only a few remnant sites in Central Europe, and their populations have been further declining in recent years. Targeted conservation actions, including habitat management at remaining sites, ex situ breeding, and (re)introductions, are being taken in Austria, the Czech Republic, and Germany.

show abstract

Improving knowledge of the subgenus Agrodiaetus (Lepidoptera: Lycaenidae: Polyommatus) in Eastern Europe: Overview of the Romanian fauna

Cited by 6 publications

References 31 publications

Integrative analysis reveals cryptic speciation linked to habitat differentiation within Albanian populations of the anomalous blues (Lepidoptera, Lycaenidae, Polyommatus Latreille, 1804)

Integrative analysis reveals cryptic speciation linked to habitat differentiation within Albanian populations of the anomalous blues (Lepidoptera, Lycaenidae, Polyommatus Latreille, 1804)

Genetics and extreme confinement of three overlooked butterfly species in Romania call for immediate conservation actions

Extremely Endangered Butterflies of Scattered Central European Dry Grasslands Under Current Habitat Alteration

Contact Info

Product

Resources

About

Improving knowledge of the subgenus Agrodiaetus (Lepidoptera: Lycaenidae: Polyommatus) in Eastern Europe: Overview of the Romanian fauna

Cited by 6 publications

References 31 publications

﻿Integrative analysis reveals cryptic speciation linked to habitat differentiation within Albanian populations of the anomalous blues (Lepidoptera, Lycaenidae, Polyommatus Latreille, 1804)

﻿Integrative analysis reveals cryptic speciation linked to habitat differentiation within Albanian populations of the anomalous blues (Lepidoptera, Lycaenidae, Polyommatus Latreille, 1804)

Genetics and extreme confinement of three overlooked butterfly species in Romania call for immediate conservation actions

Extremely Endangered Butterflies of Scattered Central European Dry Grasslands Under Current Habitat Alteration

Contact Info

Product

Resources

About

Integrative analysis reveals cryptic speciation linked to habitat differentiation within Albanian populations of the anomalous blues (Lepidoptera, Lycaenidae, Polyommatus Latreille, 1804)

Integrative analysis reveals cryptic speciation linked to habitat differentiation within Albanian populations of the anomalous blues (Lepidoptera, Lycaenidae, Polyommatus Latreille, 1804)