Involvement of Cis-Acting Elements in Molecular Regulation of JH-Mediated Vitellogenin Gene 2 of Female Periplaneta americana

Abstract

Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal gonadotropin that stimulates vitellogenesis in hemimetabolous insects. In this study, we cloned and characterized the Periplaneta americana Vitellogenin 2 (Vg2) promoter. Multiple sites for putative transcription factor binding were predicted for the 1,804 bp Vg2 promoter region, such as the Broad-Complex, ecdysone response element (EcRE), GATA, Hairy, JH response element (JHRE), and Methoprene (Met)-binding motif, among others. Luciferase reporter assay has identified that construct −177 bp is enough to support JH III induction but not 20E suppression. This 38 bp region (from −177 to −139 bp) contains two conserved response element half-sites separated by 2 nucleotides spacer (DR2) and is designated as Vg2RE (−168GAGTCACGGAGTCGCCGCTG−149). Mutation assay and luciferase assay data using mutated constructs verified the crucial role of G residues in Vg2RE for binding the isolated fat body nuclear protein. In Sf9 cells, a luciferase reporter placed under the control of a minimal promoter containing Vg2RE was induced by JH III in a dose- and time-dependent manner. Nuclear proteins isolated from previtellogenic female fat body cells bound to Vg2RE, and this binding was outcompeted by a 50-fold excess of cold Drosophila melanogaster DR4 and Galleria mellonella JH binding protein response elements (Chorion factor-I/Ultraspiracle). Affinity pull-down experiment with nuclear extracts of previtellogenic female fat body, using 31-bp probe Vg2RE as bait, yielded a 71 kDa candidate nuclear protein that may mediate the regulatory action of the JH III.

Effect of Tachinid Parasitoid Exorista japonica on the Larval Development and Pupation of the Host Silkworm Bombyx mori

“…In general, changes in the JH titer are due to alterations in JH synthesis by the corpora allata of the host and in the activity of host metabolic enzymes such as JH esterase (JHE). Alterations in host ecdysteroid titers usually trigger a cascade of 20E-responsive genes [i.e., transcription factor genes BrC , E74 , E75 , Hr3 , E93 , and Fushi-tarazu factor 1 ( Ftz-f1 )] after binding with the ecdysone receptor/ultraspiracle (EcR/USP) receptor complex, causing disturbance in development and metamorphosis ( Lin et al, 2017 ; Elgendy et al, 2021 ). For example, parasitoids in the genus Chelonus induce precocious onset of metamorphosis followed by developmental arrest in prepupa of the lepidopteran hosts through regulating host JH and ecdysteroid production ( Pfister-Wilhelm and Lanzrein, 1996 ; Jones et al, 2010 ).…”

Mining gene expression data for rational identification of novel drug targets and vaccine candidates against the cattle tick, Rhipicephalus microplus

“…No data for USP were found. Based on (a) the downregulation of the Halloween Genes and associated 20E synthesis, and (b) severe disruption of the cytoskeleton as discussed below and (c) the downregulation of vitellogenin which is a 20E response element regulated gene (Elgendy et al 2021 ; Zhu et al 2007 ), we propose that the EcR remains cytoplasmic and does not translocate to the nucleus to activate transcription (Fig. 3 ).…”

Hexamerin and allergen are required for female reproduction in the American cockroach, Periplaneta americana

“…Besides, multiple potential transcription factor binding sites were predicted in Vg2 promoter region in the American cockroach, including the Broad‐Complex, ecdysone response element, GATA, Hairy, JH response element, and Methoprene‐binding motif (Elgendy et al. , 2021). Although Kr‐h1 does not directly bind to the Vg promoter, these studies suggest the involvement of various transcription factors in regulating Vg expression.…”