Isolation and characterization of cDNA encoding chicken egg yolk aminopeptidase Ey

Abstract

Aminopeptidase Ey (EC 3.4.11.20) from chicken (Gallus gallus domesticus) egg yolk is a homodimeric exopeptidase with a broad specificity for N-terminal amino acid residues at P1 position of the substrate. Aminopeptidase Ey is a 300-k metalloexopeptidase, containing 1.0 g atom of zinc per mole of a subunit with a relative molecular mass of 150 k. A full-length cDNA was cloned from chicken (female) liver cDNA library. Analysis of the 3196-base pairs (bp) nucleotide sequence of the cDNA revealed a single open reading frame coding for 967 amino acid residues. The coding region of aminopeptidase Ey gene, apdE, occupies 2901 bp of the cDNA. The predicted amino acid sequence of the enzyme is 66, 65, 64 and 63% identical with those of aminopeptidases N (EC 3.4.11.2) from human, pig, rabbit and rat, respectively. Aminopeptidase Ey contains the metallo-binding sequence motif, His-Glu-Xaa-His, found in zinc metallopeptidases. Zinc binding sites, His-386, His-390 and Glu-409, and catalytic site, Glu-387, were conserved in the homologous aminopeptidases N.

Aminopeptidase N during the ontogeny of the chick

“…Total RNA was extracted from single embryos and semi‐quantitative RT‐PCR carried out, as described previously (Larger et al, 2004). Primers were designed based on the published chicken APN sequence as published in Midorikawa et al (1998): 5′‐GACA‐ACGCCTACTCCTCCATTGGC‐3′ (forward) and 5′‐CACAGA‐AGGTCTCTCCACCGTGGA‐3′ (reverse). DNA was amplified by means of 24 standard PCR cycles, with an annealing temperature ( T m ) of 63°C.…”

“…The chicken APN gene was subcloned by extracting total RNA from 10‐day‐old chick embryo mesonephroi, using the RNeasy mini kit (Qiagen, Valencia, CA). A complementary DNA corresponding to the entire APN gene was amplified by RT‐PCR (30 cycles, T m =56°C), using primers designed from the published in chicken APN sequence Midorikawa et al (1998): 5′‐ATGGCAGCCGGCTTCTTCAT‐3′ (forward) and 5′‐GGCTAGCTGGAGGCGGTCTC‐3′ (reverse). The product was inserted into the pCRII vector, using the TOPO‐TA cloning kit (Invitrogen, Cergy‐Pontoise, France).…”

“…APN is a membrane‐bound zinc metallopeptidase (Hooper, 1994) that has been identified primarily in mammals (human, pig, rat) (Barrett et al, 1998). However, an ortholog has also been purified from chick (Midorikawa et al, 1998; Gal‐Garber and Uni, 2000). APN is found in almost all adult mammal tissues, but is preferentially found in the re‐absortive epithelia of the intestine and the kidney, the bile canaliculi of the liver, the pancreas (Bordessoule et al, 1993; Sjostrom et al, 2000), the blood‐brain barrier‐associated pericytes (Kunz et al, 1994), the central nervous system (Noble et al, 2001), and the synaptic membranes (Matsas et al, 1985).…”

The chicken egg yolk plasma and granule proteomes

“…In addition to these major proteins, yolk was reported to contain many enzymes, which were often characterized by their activity only [1,13]. Important exceptions were cathepsin D [14], which was suggested to be a key enzyme in yolk protein maturation, and aminopeptidase Ey [15]. For both the cDNA was cloned and sequenced.…”

The role of feline aminopeptidase N as a receptor for infectious bronchitis virus

“…It is also expressed on non-hematopoetic tissue including fibroblasts [35], synaptic membranes in the central nervous system [6], epithelial cells from the renal proximal tubules and the intestinal brush border, and endothelial and epithelial cells of the respiratory tract [8,12,34,35]. Most recently APN has been isolated from chicken embryo yolk [32] and chicken intestine [14]. The feline aminopeptidase N has been shown to serve as a receptor for feline, canine, porcine and human coronaviruses in group I [38,39].…”