Isolation of cDNAs Encoding the <i>Drosophila</i> GAGA Transcription Factor

Soeller, Walter C.; Oh, Chang-Sik; Kornberg, Thomas B.

doi:10.1128/mcb.13.12.7961-7970.1993

Cited by 15 publications

(12 citation statements)

References 46 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Inverted CT repeats, or GAGA boxes, have been hypothesized to play a role in the transcriptional regulation of a variety of mammalian genes (31,32). GAGA-binding proteins have been identified (33)(34)(35)(36). For example, in human proximal tubule cells, an 18 kDa nuclear protein has been detected to bind to the GAGA box of the promoter region of human angiotensin II type I receptor gene (37).…”

Section: Discussionmentioning

confidence: 99%

Identification and Characterization of an Angiogenin-Binding DNA Sequence That Stimulates Luciferase Reporter Gene Expression

Tsuji

Riordan

et al. 2002

Biochemistry

View full text Add to dashboard Cite

Angiogenin undergoes nuclear translocation in endothelial and smooth muscle cells where it accumulates in the nucleolus and binds to DNA. Nuclear translocation of angiogenin is necessary for its biological activity and is mediated by an endocytotic pathway that is independent of the microtubule system and lysosomal processing. Because the nucleolus is a subnuclear organelle containing clusters of transcriptionally active ribosomal RNA genes, we studied the binding of angiogenin to the intergenic spacer of the ribosomal RNA gene where many of the transcription regulatory elements are located. Here we report that angiogenin binds to CT repeats that are abundant in the nontranscribed region of the ribosomal RNA gene. An angiogenin-binding DNA sequence (CTCTCTCTCTCTCTCTCCCTC) has been identified and designated angiogenin-binding element (ABE). ABE binds angiogenin specifically and exhibits angiogenin-dependent promoter activity in a luciferase reporter system. CT repeats, or inverted GA box, which are abundantly distributed in the eukaryotic genome and are often located in the 5'-flanking region, have been implicated in regulating gene expression. We have previously shown that angiogenin stimulates rRNA synthesis. The present results suggest that the nuclear function of angiogenin may not only be related to rRNA production but also play a role in regulating expression of genes containing CT repeats.

show abstract

Section: Discussionmentioning

confidence: 99%

Identification and Characterization of an Angiogenin-Binding DNA Sequence That Stimulates Luciferase Reporter Gene Expression

Tsuji

Riordan

et al. 2002

Biochemistry

View full text Add to dashboard Cite

show abstract

“…DNAbinding domains from the zinc-finger domains (ZFDs) were amplified using template DNA encoding: mouse early growth response (Egr) protein Egr-1 (13), which encodes a protein identical to that in humans, GenBank accession number J04089, purchased from ATCC; chicken GATA-1 (14), I.M.A.G.E. Consortium CloneID 439605, purchased from Invitrogen; and GAGA factor (15), Drosophila cDNA clone LD30706, purchased from Invitrogen. The following sense and anti-sense primers were used: Egr-1, CGCG-GATCCTGTCATGAACGCCCATATGCTTGC and CG-CAGTCGACTTAGTCCTTCTGTCTTAAATGGAT; GATA-1, CGCGGATCCTGTAAACGGGCAGTCACCCAATGC FIGURE 1: Schematic of recombinant proteins.…”

Section: Methodsmentioning

confidence: 99%

Single-Molecule Detection of Transcription Factor Binding to DNA in Real Time: Specificity, Equilibrium, and Kinetic Parameters

et al. 2006

View full text Add to dashboard Cite

Specificity and temporal control of transcriptional machinery are encoded within sequence-specific transcription factors, of which there are thousands in mammalian genomes. Efforts to completely decipher this code will require an understanding of the DNA binding thermodynamic and kinetic properties displayed by each transcription factor, a daunting task given the current methodologies for measuring these interactions. Here, we present a novel methodology to quantify the binding of proteins to target DNA molecules based on single-molecule detection and real-time counting of individual free and bound fluorescently tagged molecules flowing past a detection device. Using this technology, we measured DNA binding by fluorescently tagged domains of four distinct transcription factors, namely, human early growth response protein Egr-1, vertebrate GATA-1, Drosophila GAGA factor, and lambda bacteriophage Cro repressor. These proteins represent different structural classes (zinc-finger and helix-turn-helix), quaternary states (monomeric and dimeric), and relative affinities (high, intermediate, and low). Specific binding of each protein to its cognate DNA target was demonstrated at low picomolar concentrations. The equilibrium (Kd) and kinetic (kon and koff) constants governing DNA binding by one of these transcription factors, that of Egr-1, were measured using this approach. Kd values obtained from three different types of saturation titrations were reproducible and consistent, yielding values between 10 and 14 pM that, along with the kinetic constants, agree closely with literature values. Because this methodology offers several significant advantages over other existing approaches, namely, real-time determination, requirement for small amounts of reagents, high reproducibility, exquisite sensitivity, and amenability to high-throughput analysis, it is suitable for characterizing DNA-binding proteins as well as other interacting pairs of molecules that can be fluorescently tagged.

show abstract

“…Recombinant proteins were expressed from pAR-GAGA-519 (27), pAR-GAGA-581 (22), and pET-3a/Adf-1 (a kind gift of Dr R. Tjian) (26) in the Escherichia coli BL21 pLysS strain and purified by chromatography over Heparin agarose. The purified proteins were ∼90% pure according to Coomassie blue staining.…”

Section: Expression and Purification Of Recombinant Transcription Fac...mentioning

confidence: 99%

Specific local histone-DNA sequence contacts facilitate high-affinity, non-cooperative nucleosome binding of both Adf-1 and GAGA factor

Gao

Benyajati

1998

Nucleic Acids Research

View full text Add to dashboard Cite

Sequence-specific transcription factors need to gain access to regulatory sequences in chromatin. Previous studies utilizing model systems have suggested many mechanisms involved in this process. It is unclear however how these findings relate to natural promoters. The Drosophila alcohol dehydrogenase ( Adh ) gene distal promoter is organized into an ordered nucleosome array before multiple transcription factors recognize their sites within this nucleosomal context and activate transcription. Here we used a purified in vitro system to study the binding of the ubiquitous Drosophila transcription factors Adf-1 and GAGA factor to the Adh distal promoter in chromatin. Several nucleosome core particles were assembled on 150 bp DNA fragments containing the Adh distal cis -acting elements in the natural promoter context but different DNA-histone environments. We found that the Adh distal promoter regulatory sequences can position nucleosomes in the same rotational setting as observed in vivo. In one particular nucleosome position, the wrapping of the Adf-1 and adjacent GAGA factor binding sitesaround the histone octamer creates a unique local DNA conformation. High-affinity but non-cooperative nucleosome binding of Adf-1 and GAGA factortherefore occurs, in contrast to the inhibition of Adf-1 and GAGA factor binding in other nucleosome positions. Thus, local histone-DNA sequence contact giving rise to a specific asymmetric nucleosome structure may play important roles in modulating the affinities of transcription factors for their nucleosomal sites.

show abstract

Isolation of cDNAs Encoding the Drosophila GAGA Transcription Factor

Cited by 15 publications

References 46 publications

Identification and Characterization of an Angiogenin-Binding DNA Sequence That Stimulates Luciferase Reporter Gene Expression

Identification and Characterization of an Angiogenin-Binding DNA Sequence That Stimulates Luciferase Reporter Gene Expression

Single-Molecule Detection of Transcription Factor Binding to DNA in Real Time: Specificity, Equilibrium, and Kinetic Parameters

Specific local histone-DNA sequence contacts facilitate high-affinity, non-cooperative nucleosome binding of both Adf-1 and GAGA factor

Contact Info

Product

Resources

About