Lipocalin 2 in the central nervous system host response to systemic lipopolysaccharide administration

Abstract

BackgroundLipocalin 2 (Lcn2) is a bacteriostatic factor that may also modulate cellular function, however, little is known concerning the expression or role of Lcn2 in CNS inflammation. Therefore, here we investigated the regulation and possible function of Lcn2 in the CNS following peripheral lipopolysaccharide (LPS) injection in mice.MethodsA murine model for systemic endotoxemia was used in this study. Wild type or Lcn2 KO mice (both genotypes C57BL/6 strain) were given either a single or dual, staggered intraperitoneal injections of purified E. coli LPS or vehicle alone. The brain was examined for the expression and location of Lcn2 mRNA and protein and various markers for neuroinflammation were analyzed.ResultsAlthough undetectable under physiological conditions, both Lcn2 mRNA and protein were induced to high levels in the brain after LPS injection. By contrast, RNA corresponding to the putative Lcn2 (termed 24p3R) receptor was present at high levels in the normal brain and remained unaltered by LPS injection. Differences between Lcn2 and 24p3R mRNA expression were found at the anatomic and cellular level. Endothelial cells, microglia and the choroid plexus but not neurons were identified as the main cellular sources for Lcn2 mRNA in the CNS. By contrast, 24p3R mRNA was detected in neurons and the choroid plexus only. Lcn2 protein was found to have a similar cellular localization as the corresponding RNA transcripts with the exception that subsets of neurons were also strongly positive. Various inflammatory, glial, and iron handling markers were analyzed and found to have similar alterations between WT and Lcn2 KO animals.Conclusions1) Lcn2 production is strongly induced in the CNS by systemic LPS injection, 2) in addition to Lcn2 production at key gateways of bacterial entry to the CNS, neurons may be a target for the actions of Lcn2, which is apparently taken up by these cells, and 3) the cellular functions of Lcn2 in the CNS remain enigmatic.

The Bacteriostatic Protein Lipocalin 2 Is Induced in the Central Nervous System of Mice with West Nile Virus Encephalitis

“…Lcn2 is known to be a secreted protein (7), and our evidence here suggests that this secreted Lcn2 is also deposited in the parenchyma. With the exception of astrocytes, a similar cellular localization of Lcn2 mRNA and protein was found in the brain following systemic injection of lipopolysaccharide (LPS) in mice (20), suggesting that Lcn2 may play a more general role in the cellular response to infection.…”

“…The densities of the individual protein bands were normalized to that of the loading control (GAPDH) and the means Ϯ standard errors of the means (SEM) were calculated using Prism 4 software (GraphPad Inc., San Diego, CA, USA). The specificity of the antibody used for immunoblot analysis for Lcn2 had been confirmed previously (20).…”

“…Brains were removed from virus-infected and sham-infected control mice and fixed overnight in 4% paraformaldehyde in phosphate-buffered saline (pH 7.4) at 4°C. Paraffin-embedded sections (8 m) were incubated with 33 P-labeled cRNA probes transcribed from the linearized Lcn2 RPA plasmid and processed for in situ hybridization (ISH) as described previously (20). Sections were then processed for immunohistochemistry to detect astrocytes, microglia, and neurons as described above.…”

“…To analyze virus-related gene expression in the brain of WNVinfected mice, RNase protection assay (RPA) was performed. In addition to probe templates for genes that had been generated and reported previously (20), probes were synthesized as follows: for retinoic acid-inducible gene 1 (RIG-I), forward primer,AATGAATTCTGCCTCACTCTTCCTCCAGT, and reverse primer, AATAAGCTTGCGGTCTTAGCATCTCCAAC); for melanoma differentiation-associated protein 5 (MDA5), forward primer, AA TGAATTCTGACGAGTGTCTCCACTTGC, and reverse primer, AATAAG CTTGACTGCCTCCTTGTTGGTGT; and for TLR3, forward primer, AAT GAATTC GGGAACGGGGGTCCAACTGGAGAA, and reverse primer, AA TAAGCTTCTCTGTGAGGTG GGGGTTCAGTTG.…”

Phenotypic Polarization of Activated Astrocytes: The Critical Role of Lipocalin-2 in the Classical Inflammatory Activation of Astrocytes

“…LCN2 was also shown to play an important role in iron delivery (13,17), angiogenesis (18), febrile response (19), insulin resistance (20), and inflammation as an acute-phase protein (21). Recently, we (22) and other investigators (23)(24)(25) reported that brain glial cells express and secrete LCN2 under inflammatory conditions and that LCN2 mediates reactive astrocytosis (26). Nevertheless, the functional role of LCN2 in the CNS is far from clear.…”