Lrig3 regulates neural crest formation inXenopusby modulating Fgf and Wnt signaling pathways

Abstract

Leucine-rich repeats and immunoglobulin-like domains 3 (Lrig3) was identified by microarray analysis among genes that show differential expression during gastrulation in Xenopus laevis. Lrig3 was expressed in the neural plate and neural crest (NC) at neurula stages, and in NC derivatives and other dorsal structures during tailbud stages. A prominent consequence of the morpholino-induced inhibition of Lrig3 expression was impaired NC formation, as revealed by the suppression of marker genes, including Slug, Sox9 and Foxd3. In the NC induction assay involving Chordin plus Wnt3a-injected animal caps, Lrig3 morpholino inhibited expression of Slug, Sox9 and Foxd3, but not of Pax3 and Zic1. In line with this, Lrig3 knockdown prevented NC marker induction by Pax3 and Zic1, suggesting that Lrig3 acts downstream of these two genes in NC formation. Injection of Lrig3 and Wnt3a led to low-level induction of NC markers and enhanced induction of Fgf3, Fgf4 and Fgf8 in animal caps, suggesting a positive role for Lrig3 in Wnt signaling. Lrig3 could attenuate Fgf signaling in animal caps, did interact with Fgf receptor 1 in cultured cells and, according to context, decreased or increased the induction of NC markers by Fgf. We suggest that Lrig3 functions in NC formation in Xenopus by modulating the Wnt and Fgf signaling pathways.KEY WORDS: Fgf8, MAPK, Neural crest, Slug, Wnt3a, Xenopus laevis, Leucine-rich repeats protein, Animal cap, DNA microarray Development 135, 1283Development 135, -1293Development 135, (2008 DEVELOPMENT Microarray and data analysisThe dissected explants were homogenized in Stat 60 (TEL TEST), RNA was treated with DNase I and purified using RNeasy kit (Qiagen). Biotinylated probe was prepared from 100 ng total RNA using the OVATION RNA amplification system (Nugen Technologies). Probes were hybridized to Xenopus genome arrays (Affymetrix) according to the manufacture's instructions. Hybridized arrays were processed by the GeneChip Fluidics system (Affymetrix), and scanned in the GeneChip Scanner (Affymetrix). Gene expression profiles were analyzed by the GCOS software (Affymetrix). DNA constructsThe ORF of Lrig3 was cloned into pCS2+ (Turner and Weintraub, 1994) or into pCS2flag, pCS2myc and pCS2GFP. The tags were located c-terminal to Lrig3. Deletion mutants of Lrig3 were generated by PCR and subcloned into pCS2myc. Morpholino oligoThe splicing morpholino (Genetools) against Lrig3 (L3MO) recognizes both pseudo-alleles is GGGTTTCTGAAAGATAAAAACAAGC, and the Control-MO is CCTCTTACCTCAGTTACAATTTATA. RESEARCH ARTICLEDevelopment 135 (7) lacZ staining was performed as described (Zhao et al., 2001). Whole-mount in situ hybridization was performed as described (Harland, 1991). The following probes were used: Sox2 (Kishi et al., 2000), Rx2a (Yoshitake et al., 1999), Krox20 (Bradley et al., 1993, Slug (Snail2) (Mayor et al., 1995), Sox9 (Spokony et al., 2002), Ap2a (Luo et al., 2002), Inca (Luo et al., 2007), Myc (Bellmeyer et al., 2003), Twist (Hopwood et al., 1989) and Traf4 (this laboratory) were examined. Al...

Efficient targeted gene disruption in Xenopus embryos using engineered transcription activator-like effector nucleases (TALENs)

“…X. tropicalis and X. laevis were treated with human chorionic gonadotropin as described (23,24). The TALEN and ZFN plasmids were linearized by NotI, and mRNAs were synthesized by the mMessage mMachine kit (Ambion).…”

Heat Shock 70-kDa Protein 5 (Hspa5) Is Essential for Pronephros Formation by Mediating Retinoic Acid Signaling

“…Whole Mount in Situ Hybridization, ␤-Galactosidase (LacZ) Staining, and Vibratome Sectioning-Whole mount in situ hybridizations were performed according to the standard protocol (32,33). LacZ staining was carried out as published previously (34).…”

“…About 20 embryo animal caps were collected to extract RNA (33). For pronephros induction, the dissected animal caps were treated with activin at 10 mg/ml and atRA at 10 Ϫ4 M for 3 h and then transferred into animal cap culture medium until the sibling embryos reached stage 15 or 32.…”

Mechanisms driving neural crest induction and migration in the zebrafish andXenopus laevis

“…153 The initial steps of this process appear to be mediated by transcription factors, such as Slug/Snail2, Snail1 and Twist, the accessory protein Irig3 is required for the expression of the neural crest markers slug/snail2, sox9 and foxd3, but not pax3 and zic1. 133 Blocking chordin expression (but not Wnt signaling) eliminated the expression of the neural plate marker sox2, 9 although whether the level of sox2 (or sox3) expression was altered in Wnt-antagonist expressing explants was not reported (see above). Both chordin and wnt8 are expressed in the dorsal marginal zone of the gastrula stage embryo, although whether they are expressed in the same cells is not clear.…”