Macrophage migration inhibitory factor is overexpressed in pancreatic cancer tissues and impairs insulin secretion function of β-cell

Abstract

BackgroundUnderstanding the pathogenic mechanism of pancreatic cancer associated diabetes (PCDM) might help yield biomarkers for the early diagnosis of pancreatic cancer (PC) from population with new-onset diabetes. In the current study, we sought to determine the role of macrophage migration inhibitory factor (MIF) in PCDM pathogenesis.MethodsThe protein and mRNA levels of MIF in paraffin-embedded human PC samples, chronic pancreatitis specimens, and normal pancreas were measured by immunohistochemistry and quantitative reverse-transcriptase polymerase chain reaction. We measured serum levels of MIF in PC patients and controls. The biologic impacts of MIF overexpression on insulin secretion function of mice islets and β cells (HIT-T15) were investigated in vitro.ResultsMIF expression was significantly increased in pancreatic cancer tissues compared with chronic pancreatitis or normal pancreas specimens. The insulin secretion function of both islets and HIT-T15 cells was impaired by indirect co-cultured with PC cells or treated with conditioned media from them. Stable MIF knock-down significantly decreased the diabetogenic effect of PC cells, while MIF knock-in HPDE6 cells demonstrated a strong inhibitory effect on insulin secretion function of islets and HIT-T15 cells. MIF impaired βcell function by depressing the Ca2+ currents, decreasing L-type Ca2+ channel α1 subunit protein expression level, and enhancing p-Src activity. Mean serum level of MIF was significant higher in new-onset diabetes associated PC patients in comparison with other groups.ConclusionsMIF is up-regulated in patients with pancreatic cancer and causes dysfunction of insulin secretion in β-cells.

Involvement of macrophage migration inhibitory factor in cancer and novel therapeutic targets

“…For example, a previous study demonstrated that in gastric cancer, positive MIF expression rates were 12, 52 and 96% in normal mucosal, gastritis and gastric cancer tissues, respectively (18). Similar observations have also been reported in pancreatic cancer, melanoma, hepatocellular carcinoma, malignant glioma and cervical adenocarcinoma (13,(19)(20)(21)(22).…”

Canavanine induces insulin release via activation of imidazoline I3 receptors

“…In the present study we used the pancreatic β ‐cell line HIT‐T15 to investigate the effects of canavanine on pancreatic cells, with the sulphonylurea glibenclamide used as a positive control. HIT‐T15 cells are a hamster‐derived insulin‐secreting cell line and the protein expression and exocytosis of this cell line are similar to those of islets . Glibenclamide is widely used to stimulate insulin secretion .…”

“…HIT-T15 cells are a hamster-derived insulin-secreting cell line and the protein expression and exocytosis of this cell line are similar to those of islets. 22 Glibenclamide is widely used to stimulate insulin secretion. 23,24 The findings of the present study indicate that HIT-T15 cells exposed to canavanine increased insulin secretion to a level similar to that induced by glibenclamide at the same concentration.…”

D‐dopachrome tautomerase is over‐expressed in pancreatic ductal adenocarcinoma and acts cooperatively with macrophage migration inhibitory factor to promote cancer growth

“…The high efficient knockdown lentiviral constructs for MIF (pGIPZ‐shMIF‐1, shMIF‐2) and DDT (pGIPZ‐shDDT‐1 and pGIPZ‐shDDT‐2) were obtained from Open Biosystems (Rockford, IL). The third lentiviral construct for MIF or DDT knockdown (shMIF‐3 and shDDT‐3, respectively) was generated by using the shRNA design software from Dharmacon siDESIGN Center (http://www.dharmacon.com/sidesign/) as described previously . The oligos were 5′–TAATAGTTGATGTAGACCCGG–3′ for shMIF‐3 and 5′–GCCAGGACCGGATACTTAT–3′ for shDDT‐3.…”