Macropinocytosis activated by oncogenic Dbl enables specific targeted delivery of Tat/pDNA nano-complexes into ovarian cancer cells

Niu, Xiuran; Gao, Zhihui; Qi, Shanshan; Su, Linjia; Yang, Nan; Luan, Xiuli; Li, Jia; Zhang, Qing; An, Yingli; Zhang, Sihe

doi:10.2147/ijn.s171361

Cited by 19 publications

(23 citation statements)

References 46 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The pLV-RNAi system (BIOSETTIA, SORT-B19) was utilized to produce Arf6-KD (knocked-down) stable cell lines. Three independent Arf6-targeting shRNA (A1: AAAAGGAAGGTGCTATCCAAAATTTGGATCCAAATTTTGGATAGCACCTTCC, A2: AAAACAACAATCCTGTACAAGTTGATTGGATCCAATCAACTTGTACAGGATTGTTG, and A3: AAAAGCTCACATGGTTAACCTCTAATTGGATCCAATTAGAGGTTAACCATGTGAGC) were generated as previously described [29]. Arf6(wt) and Arf6(Q67L) plasmids were transfected in liver cancer cells for gene over-expression.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Arf6-driven endocytic recycling of CD147 determines HCC malignant phenotypes

et al. 2019

J Exp Clin Cancer Res

Self Cite

View full text Add to dashboard Cite

BackgroundAdhesion molecules distributed on the cell-surface depends upon their dynamic trafficking that plays an important role during cancer progression. ADP-ribosylation factor 6 (Arf6) is a master regulator of membrane trafficking. CD147, a tumor-related adhesive protein, can promote the invasion of liver cancer. However, the role of Arf6 in CD147 trafficking and its contribution to liver cancer progression remain unclear.MethodsStable liver cancer cell lines with Arf6 silencing and over-expression were established. Confocal imaging, flow cytometry, biotinylation and endomembrane isolation were used to detect CD147 uptake and recycling. GST-pull down, gelatin zymography, immunofluorescence, cell adhesion, aggregation and tight junction formation, Transwell migration, and invasion assays were used to examine the cellular phenotypes. GEPIA bioinformatics, patient’s specimens and electronic records collection, and immunohistochemistry were performed to obtain the clinical relevance for Arf6-CD147 signaling.ResultsWe found that the endocytic recycling of CD147 in liver cancer cells was controlled by Arf6 through concurrent Rab5 and Rab22 activation. Disruption of Arf6-mediated CD147 trafficking reduced the cell-matrix and cell-cell adhesion, weakened cell aggregation and junction stability, attenuated MMPs secretion and cytoskeleton reorganization, impaired HGF-stimulated Rac1 activation, and markedly decreased the migration and invasion of liver cancer cells. Moreover, high-expression of the Arf6-CD147 signaling components in HCC (hepatocellular carcinoma) was closely correlated with poor clinical outcome of patients.ConclusionsOur results revealed that Arf6-mediated CD147 endocytic recycling is required for the malignant phenotypes of liver cancer. The Arf6-driven signaling machinery provides excellent biomarkers or therapeutic targets for the prevention of liver cancer.

show abstract

Section: Methodsmentioning

confidence: 99%

“…After subjecting the collected pellets to SDS-PAGE, the GTP-bound Rab5 and Rab22 in samples were determined by Western blot. The Rac1-GTP level was assessed using GST-PAK-CRIB immobilized beads as previously described [29, 32, 33].…”

Section: Methodsmentioning

confidence: 99%

Arf6-driven endocytic recycling of CD147 determines HCC malignant phenotypes

et al. 2019

J Exp Clin Cancer Res

Self Cite

View full text Add to dashboard Cite

show abstract

“…According to bioinformatics analysis, RAC1 was enriched in various BPs, such as ‘regulation of receptor-mediated endocytosis’, ‘cell morphogenesis’, ‘cellular component morphogenesis’ and ‘epithelial cell differentiation’. These BPs play important roles in the growth, migration and differentiation of tumor cells, thereby contributing to the occurrence and development of cancer (77–80). Additionally, the data in the present study revealed that the upregulation of RAC1 was associated with poorer OS in patients with HCC.…”

Section: Discussionmentioning

confidence: 99%

Prognostic value and prospective molecular mechanism of miR‑100‑5p in hepatocellular carcinoma: A comprehensive study based on 1,258 samples

Qin

Lin

et al. 2019

Oncol Lett

View full text Add to dashboard Cite

The prognostic value and molecular mechanism of microRNA-100-5p (miR-100-5p) in hepatocellular carcinoma (HCC) are still unclear. To explore the prognostic value and the mechanism of miR-100-5p in HCC, the present study analyzed the results of 18 previous studies and bioinformatic datasets. The clinical significance of miR-100-5p and its targets in HCC were investigated using The Cancer Genome Atlas and the Gene Expression Omnibus, as well as relevant literature. In total, 12 online tools were used to predict the target genes of miR-100-5p. Bioinformatics analysis and Spearman correlation analysis were performed, and genomic alterations of the hub genes were evaluated. A meta-analysis with 1,258 samples revealed that miR-100-5p was significantly downregulated in HCC [standard mean difference (SMD), −0.94; 95% confidence interval (CI), −1.14 to −0.74; I2, 35.2%]. Lower miR-100-5p expression was associated with poorer clinical characteristics and a poorer prognosis for patients with HCC. Additionally, bioinformatics analysis revealed that the ‘regulation of transcription’, ‘chromatin remodeling complex’, ‘transcription regulator activity’, ‘pathways in cancer’ and ‘heparan sulfate biosynthesis’ were the most enriched terms. Furthermore, expression of histone deacetylase (HDAC)2, HDAC3, SHC-transforming protein 1 (SHC1), Ras-related protein Rac1 (RAC1) and E3 ubiquitin-protein ligase CBL (CBL) was negatively correlated with miR-100-5p expression. Among these, upregulated HDAC2 [hazard ratio (HR), 1.910; 95% CI, 1.309–2.787; P=0.0007], HDAC3 (HR, 1.474; 95% CI, 1.012–2.146; P=0.0435), SHC1 (HR, 1.52; 95% CI, 1.043–2.215; P=0.0281) and RAC1 (HR, 1.817; 95% CI, 1.248–2.645; P=0.0022) were associated with shorter survival. Alterations in HDAC2, SHC1, RAC1 and IGF1R were linked with a poorer outcome for HCC, and alternative splicing of SHC and RAC1 were significantly decreased and increased in HCC, respectively. In summary, the downregulation of miR-100-5p may be involved in the progression and prognosis of HCC. The upregulation of HDAC2, HDAC3, SHC1 and RAC1 may indicate a poorer survival rate for patients with HCC. Thus, miR-100-5p and these 4 potential target genes may provide novel therapeutic targets and prognostic predictors for patients with HCC.

show abstract

“…CD147 uptake and binding were measured as previously described 48–51 . Incubation conditions for the H18Ab complex were optimized (H18Ab, 1:500, anti-mouse AF488, 1:1000, 15 min) in HCC cells.…”

Section: Methodsmentioning

confidence: 99%

YIPF2 is a novel Rab-GDF that enhances HCC malignant phenotypes by facilitating CD147 endocytic recycle

et al. 2019

Cell Death Dis

Self Cite

View full text Add to dashboard Cite

An increased surface level of CIE (clathrin-independent endocytosis) proteins is a new feature of malignant neoplasms. CD147 is a CIE glycoprotein highly up-regulated in hepatocellular carcinoma (HCC). The ability to sort out the early endosome and directly target the recycling pathway confers on CD147 a prolonged surface half-life. However, current knowledge on CD147 trafficking to and from the cell-surface is limited. In this study, an MSP (membrane and secreted protein)-cDNA library was screened against EpoR/LR-F3/CD147EP-expressed cells by MAPPIT (mammalian protein–protein interaction trap). CD147 co-expressing with the new binder was investigated by GEPIA (gene expression profiling interactive analysis). The endocytosis, ER-Golgi trafficking and recycling of CD147 were measured by confocal imaging, flow cytometry, and biotin-labeled chase assays, respectively. Rab GTPase activation was checked by GST-RBD pull-down and MMP activity was measured by gelatin zymography. HCC malignant phenotypes were determined by cell adhesion, proliferation, migration, Transwell motility, and invasion assays. An ER-Golgi-resident transmembrane protein YIPF2 was identified as an intracellular binder to CD147. YIPF2 correlated and co-expressed with CD147, which is a survival predictor for HCC patients. YIPF2 is critical for CD147 glycosylation and trafficking functions in HCC cells. YIPF2 acts as a Rab-GDF (GDI-displacement factor) regulating three independent trafficking steps. First, YIPF2 recruits and activates Rab5 and Rab22a GTPases to the endomembrane structures. Second, YIPF2 modulates the endocytic recycling of CD147 through distinctive regulation on Rab5 and Rab22a. Third, YIPF2 mediates the mature processing of CD147 via the ER-Golgi trafficking route. Decreased YIPF2 expression induced a CD147 efficient delivery to the cell-surface, promoted MMP secretion, and enhanced the adhesion, motility, migration, and invasion behaviors of HCC cells. Thus, YIPF2 is a new trafficking determinant essential for CD147 glycosylation and transport. Our findings revealed a novel YIPF2-controlled ER-Golgi trafficking signature that promotes CD147-medated malignant phenotypes in HCC.

show abstract

Macropinocytosis activated by oncogenic Dbl enables specific targeted delivery of Tat/pDNA nano-complexes into ovarian cancer cells

Cited by 19 publications

References 46 publications

Arf6-driven endocytic recycling of CD147 determines HCC malignant phenotypes

Arf6-driven endocytic recycling of CD147 determines HCC malignant phenotypes

Prognostic value and prospective molecular mechanism of miR‑100‑5p in hepatocellular carcinoma: A comprehensive study based on 1,258 samples

YIPF2 is a novel Rab-GDF that enhances HCC malignant phenotypes by facilitating CD147 endocytic recycle

Contact Info

Product

Resources

About