Matrix Metalloproteinase-9 and Augmentation Index are Reduced with an 8-Week Green-Exercise Walking Programme

Evaluation of cardiovascular risk-lowering health benefits accruing from laboratory-based, community-based and exercise-referral exercise programmes

“…Similarly, in study 3, non-significant 1.9-fold and 1.4-fold trends towards increased expression were observed (p>0.05 in both cases). Conversely, MMP-9 (which is negatively regulated by exercise-associated signalling stimuli7) underwent decreases in expression which either attained or neared statistical significance (p<0.01 for study 1 and the adherent group from study 2; p=0.07 for study 3).…”

“…Monocytes were obtained from leucocyte samples using commercial monocyte-isolation columns (QuadroMACS separator units, LS columns and CD14 MicroBeads (Miltenyi Biotec, Bisley, UK)) according to the manufacturers’ instructions. RNA was obtained from monocyte samples, converted to cDNA and used in Fast-SYBRGreen (Applied Biosystems, Paisley, UK) or Taqman Primetime (Integrated DNA Technologies Inc, Iowa, USA) PCR-based gene expression assays as previously described 7. Oligonucleotide primers (Sigma, Poole, UK) were: ATP-Binding Cassette protein A1 (ABCA1): F: 5’ GCACTGAGGAAGATGCTGAAA 3’; R: 5’ AGTTCCTGGAAGGTCTTGTTCA 3’; cluster of differentiation isoform-36 (CD36): F: 5’ GGAAGTGATGATGAACAGCAGC 3’; R: 5’ GAGACTGTGTTGTCCTCAGCGT 3’; matrix metalloproteinase-9 (MMP-9): ‘Taqman Primetime’ code Hs00234579_m1; β-actin (‘housekeeper gene’ #1): ‘Taqman Primetime’ code 4310881E-1404039; GAPDH (‘housekeeper gene’ #2): F: 5‘CATTGACCTCAACTACATG 3’; R: 5’ TCTCCATGGTGGTGAAGAC 3’.…”

“…Thus, single exercise bouts have acute impacts on levels of blood-borne signals such as activators of the ligand-activated transcription factor PPARγ,8 10 and on expression within circulating monocytes of target genes for these signals 58–10 Similarly, sustained changes in monocytic expression patterns of these target genes are seen in participants who have undergone exercise programmes involving regular exercise over periods of >8 weeks 78 10 11 We have identified associations between such exercise-associated signalling effects and clinical parameters relevant to CVD risk: exercise-associated activation of PPARγ signalling correlates with improvements in insulin sensitivity,10 increased high-density lipoprotein (HDL) cholesterol,11 reduced arterial stiffness7 and reduced fasting plasma glucose 10.…”

“…8–10 Similarly, sustained changes in monocytic expression patterns of these target genes are seen in participants who have undergone exercise programmes involving regular exercise over periods of >8 weeks 78 10 11 We have identified associations between such exercise-associated signalling effects and clinical parameters relevant to CVD risk: exercise-associated activation of PPARγ signalling correlates with improvements in insulin sensitivity,10 increased high-density lipoprotein (HDL) cholesterol,11 reduced arterial stiffness7 and reduced fasting plasma glucose 10. Thus, our previous studies have established a group of easily measured ‘biomarkers’ that may be used to evaluate the ability of exercise programmes to achieve CVD risk-lowering clinical outcomes 5–14…”

Walks4Work: Assessing the role of the natural environment in a workplace physical activity intervention

“…Furthermore, it may be that the measures employed were not sensitive enough to identify statistically significant changes as in part they were looking at more centrally mediated changes in the ANS, whereas local changes may be occurring. Other recent research (45) suggests that an 8-week green exercise intervention may be sufficient to evoke local vascular remodeling changes. Thompson et al analyzed blood samples to identify changes in components utilized in building the extracellular matrix of the vascular walls.…”