Microorganisms that are critical for the fermentation quality of paper mulberry silage

Abstract

Silage quality remains an important issue in farming, as do limitations in the range of products suitable for animal fodder. We therefore explored the microorganisms that are critical for the fermentation quality of paper mulberry silage. Low (unwilted) and high (wilted) dry matter (DM) paper mulberry were harvested at two cutting times.These were ensiled for 0, 3, 7, 14, and 56 days, respectively. Compared with unwilted silages, wilting significantly decreased (p < 0.05) silage pH value, ammonia-N concentration, and yeast counts but increased (p < 0.05) lactic acid content. In addition, higher (p < 0.05) crude protein (CP) contents were also observed in wilted silages. Next-generation sequencing (NGS) analysis revealed that wilting reduced the abundance of Enterobacter, while increasing that of Lactobacillus. Single-molecule real-time sequencing (SMRT) revealed that the silage was enriched in the lactic acid bacteria (LAB), Lactobacillus rhamnosus after wilting, which showed a positive correlation with CP and lactic acid content. We conclude that wilting may help preserve paper mulberry silage, facilitating its use as a new fodder resource. Moreover, L. rhamnosus has the potential to be developed as a new inoculant for the modulation in wilted silages, particularly paper mulberry silage.

Soil Microbial Communities Altered by Titanium Ions in Different Agroecosystems of Pitaya and Grape

“…Microbial diversity analysis was performed based on the 16S rRNA gene for bacteria and the internal transcribed spacer ( ITS ) region for fungi. Bacterial and fungal total genomic DNA were amplified using primers specific to the full-length bacterial 16S rRNA region ( 46 ) (27F: AGRGTTTGATYNTGGCTCAG ; 1492R: TASGGHTACCTTGTTASGACTT ) and the full-length fungal ITS region ( 47 ) (ITS1: F- CTTGGTCATTTAGAGGAAGTAA ; ITS4: R-T CCTCCGCTTATTATTATGC ). The forward and reverse primers were tailed with the sample-specific PacBio barcode sequence for multichannel sequencing of each sample.…”

Exploring the Addition of Herbal Residues on Fermentation Quality, Bacterial Communities, and Ruminal Greenhouse Gas Emissions of Paper Mulberry Silage

“…The silage treatments were as follows: (i) control, no additives, (ii) SA, 5% of clove, (iii) MC, 5% of mint, and (iv) PF, 5% of purple perilla. Then, 500-g crushed fresh paper mulberry or that added with 5% of herbal residues were mixed homogenously and packed manually into vacuumsealed polyethylene plastic bags (dimensions 28 × 35 cm, Deli, Beijing, China; Guo et al, 2021). Six bags for each treatment were prepared and kept at room temperature (20-30 • C).…”

“…Six bags for each treatment were prepared and kept at room temperature (20-30 • C). After 21 and 75 days of ensiling, three bags were randomly selected and opened to analyze the fermentation parameters, bacterial communities, and chemical composition (Guo et al, 2021).…”

“…Paper mulberry (Broussonetia papyrifera L.) is widely found in any country, such as Thailand, Africa, the United States, and China. It produces a large quantity of biomass each year, ranging from 45 to 120 tons per hectare (Zhang et al, 2019;Guo et al, 2021). Paper mulberry is rich in crude protein, amino acids, flavonoids, phenolic acids, and lignans, which have the potential to promote animal growth and disease resistance.…”

“…These nutritional traits, along with high production and biologically active compounds, have turned paper mulberry into a sustainable, functional, and important protein forage resource for livestock (Cai et al, 2019;Xiong et al, 2021). However, the natural fermentation of paper mulberry is usually attributed to undesirable Enterobacter and Clostridium (Du et al, 2021;Guo et al, 2021), leading to extensive proteolysis and great economic losses. Based on the characteristics of herbal residues, we suspect that co-ensiling of herbal residues and paper mulberry might be a simple and efficient way to recycle herbal residues and produce good silage products.…”