Modeling Niemann–Pick disease type C in a human haploid cell line allows for patient variant characterization and clinical interpretation

Abstract

The accurate clinical interpretation of human sequence variation is foundational to personalized medicine. This remains a pressing challenge, however, as genome sequencing becomes routine and new functionally undefined variants rapidly accumulate. Here, we describe a platform for the rapid generation, characterization, and interpretation of genomic variants in haploid cells focusing on Niemann-Pick disease type C (NPC) as an example. NPC is a fatal neurodegenerative disorder characterized by a lysosomal accumulation of unesterified cholesterol and glycolipids. In 95% of cases, NPC is caused by mutations in the NPC1 gene, for which more than 200 unique disease-causing variants have been reported to date. Furthermore, the majority of patients with NPC are compound heterozygotes that often carry at least one private mutation, presenting a challenge for the characterization and classification of individual variants. Here, we have developed the first haploid cell model of NPC. This haploid cell model recapitulates the primary biochemical and molecular phenotypes typically found in patient-derived fibroblasts, illustrating its utility in modeling NPC. Additionally, we show the power of CRISPR/Cas9-mediated base editing in quickly and efficiently generating haploid cell models of individual patient variants in NPC. These models provide a platform for understanding the disease mechanisms underlying individual NPC1 variants while allowing for definitive clinical variant interpretation for NPC.

STAT1 gain-of-function heterozygous cell models reveal diverse interferon-signature gene transcriptional responses

“…HAP1 were previously used to study cellular responses to IFN types I, II, and III, and have well-characterized transcriptional responses to IFN type I and II 32 – 34 . In addition, they are readily amenable to transfection and CRISPR/Cas genome-editing 35 . Although HAP1 cells are originally near-haploid, like other haploid cell lines they are known to spontaneously diploidize in cell culture over time 36 .…”

Heterozygous Cell Models of STAT1 Gain-of-Function Reveal a Broad Spectrum of Interferon-Signature Gene Transcriptional Responses

“…The sgRNA vector, BPK1520_puroR, a plasmid containing a cloning site for sgRNA under control of a U6 promoter, as well as a puromycin resistance cassette, was generated as previously described. 35 The following oligonucleotides were used to clone the sgRNA required for mutant generation: E235G, Fwd CACCGATGAACTAGTGGAGTGGAAG, Rev AAACCTTCCACTCCACTAGTTCATC; K278E, Fwd CACCGCTTAAAAAGTTGGAGGAAT, Rev AAACATTCCTCCAACTTTTTAAGC; P329L, Fwd CACCGCTGAGGGTGCGTTGGCATGC, Rev: AAACGCATGCCAACGCACCCTCAGC; T385M: Fwd: CACCGGGCACGCACACAAAAGTGA, Rev: AAACTCACTTTTGTGTGCGTGCCC; D517G, Fwd: CACCGTGTGGACCAGCTGAACATGT, Rev: AAACACATGTTCAGCTGGTCCACAC; Y701C, Fwd: CACCGTGGATATATCAAGACTGAGT, Rev: AAACACTCAGTCTTGATATATCCAC.…”

“…[32][33][34] In addition, they are readily amenable to transfection and CRISPR/Cas genomeediting. 35 Although HAP1 cells are originally near-haploid, like other haploid cell lines they are known to spontaneously diploidize in cell culture over time. 36 HAP1 cells used in this study underwent cell cycle analysis, comparing their DNA content with that of known diploid cells…”

“…The sgRNA vector, BPK1520_puroR, a plasmid containing a cloning site for sgRNA under control of a U6 promoter, as well as a puromycin resistance cassette, was generated as previously described. 35 The following oligonucleotides were used to clone the sgRNA required for mutant…”

Understanding and Treating Niemann–Pick Type C Disease: Models Matter

“…Knock-down in an oligodendroglial cell line was accomplished using short interfering RNA [200]. The first NPC model based on a haploid human cell line has been introduced recently [300].…”