Molecular phenotyping uncovers differences in basic housekeeping functions among closely related species of hares (Lepus spp., Lagomorpha: Leporidae)

Abstract

Speciation is a fundamental evolutionary process, which results in genetic differentiation of populations and manifests as discrete morphological, physiological and behavioural differences. Each species has travelled its own evolutionary trajectory, influenced by random drift and driven by various types of natural selection, making the association of genetic differences between the species with the phenotypic differences extremely complex to dissect. In the present study, we have used an in vitro model to analyse in depth the genetic and gene regulation differences between fibroblasts of two closely related mammals, the arctic/subarctic mountain hare (Lepus timidus Linnaeus) and the temperate steppe-climate adapted brown hare (Lepus europaeus Pallas). We discovered the existence of a species-specific expression pattern of 1623 genes, manifesting in differences in cell growth, cell cycle control, respiration, and metabolism. Interspecific differences in the housekeeping functions of fibroblast cells suggest that speciation acts on fundamental cellular processes, even in these two interfertile species. Our results help to understand the molecular constituents of a species difference on a cellular level, which could contribute to the maintenance of the species boundary.

High quality genome assembly of the brown hare (Lepus europaeus) with chromosome-level scaffolding

“…The mitochondrial genomes of our hare cell lines (Gaertner et al ., 2022) have been sequenced for the purposes of another study using approximately 2 kb overlapping PCR-amplified fragments of mtDNA. The primers used to amplify the mountain hare mtDNA were as follows: Le93F: TTGTTTTGTAGCAAGTTTACACATGC…”

Adaptive cellular evolution or cellular system drift in hares

“…To assess this, Gaertner and colleagues established immortalized fibroblast cell lines from four individuals of each species (sampled in southern Finland) and analysed the mRNA transcriptome and multiple cellular properties. The sampled individuals differed clearly genetically, showing no indications of hybridization or introgression (Gaertner et al, 2022). Expression of several hundred orthologous genes differed by species.…”

“…Summary of the experimental set‐up (Gaertner et al (2022) and variation in life‐history and cellular traits in brown and mountain hares (coloured brown and white respectively). At the top, differences in the two species in several life‐history and physiological traits are summarized.…”

“…They share a common ancestor about 3 million years ago, differ by ~1% in sequence of orthologues and can hybridize in nature. They differ in several traits (Figure 1), notably the mountain hare grows slower, has fewer offspring and has a lower metabolic rate during winter (Angerbjörn & Flux, 1995; Gaertner et al, 2022). Differing life‐history strategies might reflect or manifest as cellular or metabolic evolution or trade‐offs.…”

“…Are the cellular functions of animals highly constrained, subject to cellular system drift or affected by positive selection? This was tackled by a new study by Kateryna Gaertner and colleagues in a From the Cover manuscript in this issue of Molecular Ecology (Gaertner et al, 2022), using fibroblasts from the closely related but ecologically distinct brown and mountain hares. This approach has both strengths and limitations, and highlights opportunities for future investigations.…”