Morpholino-based gene knockdown screen of novel genes with developmental function inCiona intestinalis

Abstract

In the present study, we conducted an extensive analysis to identify novel genes with developmental function among Ciona intestinalis genes discovered by cDNA projects. Translation of a total of 200 genes expressed during embryogenesis was suppressed by using specific morpholino antisense oligonucleotides. Suppression of the translation of any of 40 genes (one-fifth of the genes tested) was thereby shown to cause specific embryonic defects. Most of these genes have counterpart(s) in mouse and human, suggesting that the present approach will be useful for identifying candidate genes essential for the development of vertebrates. Suppression of translation of 14 of these 40 genes resulted in the `disorganized body plan' phenotype characterized by gross morphological abnormalities caused by early defects in embryogenesis. These genes encode zinc-finger, transmembrane or Pbx homeodomain proteins. The morphological features of larvae of this phenotypic class varied according to the gene suppressed, suggesting that a distinct developmental event such as tissue specification or cell cycle progression was affected in each type of larva. Suppression of the remaining 26 genes resulted in the `abnormal tail'phenotype. Some of these genes encode proteins with known functional structures such as Zn-finger and HLH motifs. Twelve genes among them are especially interesting, because their suppression produced defects in the nervous system, as demonstrated by the loss of the sensory pigment cells or palps of the adhesive organ in the knockdown larvae. These results suggest that screening for developmental genes by the reverse genetic approach in Ciona intestinalis embryos is effective for identifying novel genes with developmental functions required for the development of chordates.

brachyurynull mutant-induced defects in juvenile ascidian endodermal organs

“…1C). The fact that the mutant 411 phenotype is similar to previous reports for Ciona embryos with downregulated or knocked-down brachyury (Di Gregorio et al, 2002;Satou et al, 2001;Yamada et al, 2003) allowed us to confidently conclude that the mutant phenotype was due to a loss-of-function brachyury allele. In addition, we observed that four genes previously shown to be downstream of brachyury [noto4, noto8, prickle (pk) and tropomyosin (Hotta et al, 2000)] and laminin alpha 3/4/5 were not expressed in homozygous mutant 411 embryos (data not shown).…”

“…The structure and function of brachyury has been extensively characterized in a number of chordates, including the ascidian (Satoh, 2003;Showell et al, 2004). In ascidians, brachyury is expressed in the notochord precursor and the notochord (Corbo et al, 1997;Imai et al, 2000;Yasuo and Satoh, 1993), and experimental manipulations have confirmed its role in notochord development (Di Gregorio et al, 2002;Satou et al, 2001;Yamada et al, 2003;Yasuo and Satoh, 1998). Both the molecular pathway inducing brachyury expression in the ascidian notochord precursor, and direct and indirect downstream targets of brachyury have been well characterized (Hotta et al, 2000;Hotta et al, 2008;Imai et al, 2006;Nishida, 2005;Takahashi et al, 1999;Yagi et al, 2004).…”

“…Functional study of brachyury in ascidians has relied largely on the misexpression of DNA constructs, the downregulation of brachyury expression by targeting upstream factors, and morpholino knockdown (Di Gregorio et al, 2002;Satou et al, 2001;Takahashi et al, 1999;Yamada et al, 2003). Although these approaches have been fruitful, they frequently result in mosaic and/or incomplete knockdown.…”

AMPA glutamate receptors are required for sensory-organ formation and morphogenesis in the basal chordate

“…The MO antisense sequence was TAGTACGGCGAGACATTTTAACTGG, and the control MO sequence with five nucleotide mismatches was TAcTAgGGCGAcAgATTTTAACTcG. On the basis of previous studies, 10 fmoles MO in distilled water was injected into intact fertilized eggs (75).…”

doublesex/mab3 related-1 (dmrt1) is essential for development of anterior neural plate derivatives in Ciona

“…Fertilized wild-type eggs were injected the dmrt-MO or control-MO, 5Ј-CCTCTTACCTCAGTTACAATTTATA-3Ј, as described (Yamada et al, 2003).…”